User:Mbennie/Notebook/Oligos/IgAb-F

From OpenWetWare

Jump to: navigation, search

Sequence: gtttcttcgaattcgcggccgcttctagaggtagcacgcaatctatcttgttgg

Binding site: 22 bp

Predicted Tm: 53.7C

Received: 8/1/2007

  • Resuspended at 50uM with 428ul of TE
Personal tools