User:Maryam Yamadi/Notebook/Biology 210 at AU

From OpenWetWare

Jump to: navigation, search

Zebrafish Experiment

Purpose To analyze the effect on zebrafish development when exposed to a higher amount of protein consumption.

02/19/2016 Zebrafish Lab Set-Up

       To set up the Zebrafish experiment a control group of wells was filled with deer park water to
prevent fungal growth and the treatment condition set of wells was fills with 2mg/mL concentrated ovalbumin. Ovalbumin was used instead 

of a whey protein powder that was originally suggested to make sure that the developmental response observed in the Zebrafish is directly due to an increase in protein consumption and is not hindered with the variety of compounds found in protein supplements for humans. Twenty embryos were then selected for each group of wells and a singular embryo was placed in each individual well. Twenty embryos were assigned to the control group and then twenty embryos assigned to the treatment group. Embryos that had acquired fungus were discarded and not included in the experiment and prior to choosing particular embryos for the experiment and translucent embryos indicating no mold or contaminated growth were used. In addition, it was analyzed whether or not the embryos were in similar embryonic stages of development, which would contribute to experimental regulation. It was hypothesized that if the Zebrafish were exposed to a concentration of 2mg/ mL of protein then the fish would develop much larger physical measurements (such as length, tail, diameter, head diameter, etc.) than the equivalently aged control Zebrafish. Both groups of Zebrafish were approximately a day old before being exposed to experimental conditions and embryos are a diameter of .0009 centimeters.

02/22/2016 Day Three

       None of the control embryos have hatched at this point and the embryos remain at the same diameter of .0009 centimeters. All embryos of the treatment condition have hatched, it is still too early in development to provide detailed measurements but the entire length of 

the treatment fish are .3 centimeters and the width is .1 centimeters.

02/24/2016 Day Five Seven of the control embryos have hatched at this stage of development and are still too small to obtain detailed measurements. The length of the hatched fish is at .3 centimeters and the width is .05 centimeters with the remaining embryos still at .0009 centimeters. Seven of the treated fish are no longer living and have appeared to disintegrate within their wells because there are no remnants, no skeleton, or any remaining fragments of the Zebrafish where there once were two days prior. A photograph of one of the remaining Zebrafish is pictured below with the measurement as follows; inner eye distance .03 centimeters, girth .05 centimeters, eye diameter .04 centimeters, total body length .5 cm, and the tail length was 1 centimeter. Image:Day_5_treatment_fish_.jpg‎

02/26/2016 Day Seven

        Eight of the control fish remain alive and swimming healthily with an inner eye distance measurement of .01 centimeters, girth of .05 centimeters, eye diameter of .02 centimeters, a total body length of .3 centimeters, and a tail length of .3 centimeters. All of the ovalbumin treated fish have now disintegrated at this point leaving no remaining data. 

It is hypothesized that the protein concentration was so high that the fish could not withstand the conditions. To adjust the experiment the ovalbumin was then diluted to .5mg/mL instead of the original 2mg/mL. New fish left over from past embryo groups used in the BIO-210 lab sections were then tested with the new treatment conditions. Twenty Zebrafish, approximately two days older than the current control fish from this experiment, were placed in a petri dish and 20mLs of ovalbumin solution was added. The measurements of the new fish used are as follows; the inner eye distance is .02 centimeters, girth is .05 centimeters, eye diameter is .03 centimeters, total body length is .4 centimeters, and the tail length is 1 centimeter.

02/29/2016 Day Ten Eight of the control fish remain alive with the following measurements; inner eye distance .01 centimeters, girth .07 centimeters, eye diameter .02 centimeters, total body length .4 centimeters, and tail length is .3 centimeters. All of the new treated fish in the petri dish were found dead. Though the fish did not survive they did not disintegrate either indicating that because the skeletons of the fish remained the lowered protein concentration was effective but would need to be lower for the fish to survive the length of the Zebrafish corpses was 1 centimeter and the width was .04 centimeters. Image:Zebrafish_Dead.JPG

03/02/2016 Day Twelve Five of the control fish remain alive with the following measurements; inner eye distance .01 centimeters, girth .1 centimeters, total body length .5 centimeters, and tail length is .5 centimeters. No treatment group fish from this day.

03/04/2016 Final Day of Data Collection Day Fourteen Five of the control fish remained alive for the entire duration of the experiment with the final measurements as follows: inner eye distance .01 centimeters, girth .1cm, eye diameter .03 centimeters, total body length .5 centimeters, and tail length .5 centimeters. No treatment group fish results from this day. Final control fish pictured below. Image:Day_14_Control_fish.png‎

Conclusion Hypothesis was not supported due to the concentration of ovalbumin being too high. However, before the fish treated with protein died they were significantly larger than the control fish and hatched significantly earlier than the control fish. Though more evidence would be needed to prove this, this data indicates that the ovalbumin would have developmental effects on the zebrafish.

Vertebrate Analysis and Food Web 03/18/2016 Image:Maryam food web.png


Due to the harsh cold that inhabited transect one during the weeks of data collection, in addition to the multiple snowfalls, no vertebrates other than squirrels were observed. However, based on the research of the biome that the transect falls in it is expected that many vertebrates inhabited the transect at a given time. The large presence of nuts and acorns indicates that squirrels and chipmunks do play their part in the ecosystem in the transect. According to the birds and the rabbits, it can be inferred that these vertebrates play their part in the transect as well considering they are organisms that are often observed around campus. However, there is no hard evidence to support the existence of these vertebrates in transect one.



16S Sequence Analysis Lab Notebook 03/03/2016

Purpose The purpose of conducting PCR on the grown bacterial colonies was to identify the particular strain of bacteria developed from our transect.

Materials and Methods After watching our bacteria colony grow, we took samples from both of our colonies and inserted them into a gel sample from a Polymerase Chain Reaction. From these, we would hope to observe the expression sequences of specific genes within the bacteria.

Observations Transect one did not yield appropriate bacterial samples to result in bands from the gel electrophoresis following the polymerase chain reaction. However, looking at Eric McDonough’s lab data from his transect, which provided theoretically analogous PCR data from of an equivalent biome. It reads as follows:

"Samples 1 and 4, which were run on agarose electrophoresis gel last week and then sent out for sequencing, returned the following sequences, in which N represents unidentified base pairs. Sample 1: TGNANGCCNANCGNGTNAGANGANCGNNNTNCTGNGGNANNCTNTGNGNNAGCGNGNTGATACGGGTGCGGAACACGTGTGCAA CCTGCCTTTATCAGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAATATATTGAATGGCATCATTTGATATTGAAAACTCCGGTGGATA GAGATGGGCACGCGCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCAGTGATCTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTG GTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGAC GACGGCCCTATGGGTTGTAAACTTCTTTTGTATAGGGATAAACCTTTCCACGTGTGGAAAGCTGAAGGTACTATACGAATAAGCACCGGCTAACT CCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATCTGTAAGTCAGTGGTGA AATCTCATAGCTTAACTATGAAACTGCCATTGATACTGCAGGTCTTGAGTAAAGTANAAGTGGCTGGAATAANTAGTGTANCGGTGAAATGCATAG ATATTACTTANNAACACCAATTGCGAAGGGCAGGTCNCTATGTTTTAACTGACGCTGATGGACGAAAGCGTGGGGAGCGAACAGGATTANATACC CTGGTNGTNNNNGCCGTANACGATGCTNACTCNTTTTTNGNNCTTCNGATTCAGAGACTAAGCNAAANTGATAGTTAGNCNNCCTGGNGAGTNC NTTCNCAANAATGAAACTCANAAGAANTGACGGGGGNCCCNCNCANCCGTGNATTATGTNGTTTAATTCANNNNNCNNNNGNANCCTTNNCNAC GCTTAANNGGGATTGNGGGGGNTTAGANNNNANNNGTCTCNNCATTTCNANNTTCTNCNNGGGNNGNCGGNGGNTGGTCCCCCNNTGTANGNN NNGGTCAAGNACNNGNNGNNCCCNNT Sample 4: GCAGTCNAGCGGATGANANNAGCTTGCTCTTCGATTCAGCGGCGGANGGGTGAGTAATGCCTAGGAATCTGCCTATTAGTGGGGG ACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTAATAGATGAGCCTAGGTCG GATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTC CAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATT GTAAAGCACTTTAAGTTGGGAGGAAGGGTTGTAGATTAATACTCTGCAATTTTGACGTTACCGACAGAATAANCACCGGCTAACTCTGTGCCAN CAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCNTTAAGTTNNATGTGAAATCCCC NGGCTCNACCTGNNAGCTNCNTTCNANACTGTCNNGCTANANTATGGTANANGGTGCTGGAATTTCCTCTGTNGNNNNNCAAATNNNNANAT ANANNATTGAACNNNNNTGNCNANNNGNNNNCCTCCNCTGNTNGNCNANNCNNGTATNCGCNCCNTGNGNGNGAAACACNNGNGGNTNGN CTCCNNCGCCACNGNGTNTNCNANATNTACNANCCTTTTCGNTGNGNTNNNNNNNTATTNCNCNGNCTCNCCNNANANNTNNACNNNCANN NTNNNGNNNNGNCCNCCCTGGGGGCTCNNCNNGNNTTTTTNNNTGNCNNGNGCAAGNAANNNNNGNGGGNGTTGNNGCTNNNTNNNACAA AANNANNNNANCGCCCCNTGGTNNNGNNCNGGNNNANGGNNNNTAANANNTGGNNTGGNNNCCTNCGGGNACCNAAANNNNNGGNNGNA NNGNANNNCNNNNNCTCCCNNNCCNANNNNGGTTGG Sample 1 was considerably more definitive than Sample 4, which ultimately could only be fit to a best match of 59% due to the large number of unidentified base pairs. The table below presents the findings when each sample was run through the GeneWiz and Genomic Blast programs. Sample # Number of base pairs Identity of Bacteria % match? Sample 2 1386 Chryseobacterium sp. WR1 80% Sample 3 1397 Pseudomonas sp. Ata11 59% Sample 1 was identified as Chryseobacterium with an 80% match to the known genetic code. Chryseobacterium is gram-negative, rod-shaped, and yellow-pigmented. It is found in environments much like that of this transect, including in soil, plants, and wastewater. This sample had been characterized under the microscope as coccus-shaped, gram positive, and orange-yellow in color. As the color matches, and sample is matched relatively well to the known genetic code, it is likely that this sample is indeed Chryseobacterium, and that some error was involved both in observing the shape of the bacteria under the microscope (identification is difficult for such small organisms without use of an electron microscope) and in the gram stain procedure. Sample 4 was identified with less certainty (59%) as Pseudomonas. Pseudomonas are gram-negative and rod-shaped. As this sample was characterized under the microscope as rod-shaped but gram-positive, and the percent match to the known genetic code is so low, it is likely that this is not a correct identification of this bacteria."

Conclusion Our PCR did not give us a desired result. Data from our transect was found to be inconclusive and no data was provided.


Invertebrates and Vertebrates Lab Notebook Entry 02/19/2016

Berlese Funnel Setup

First 25mLs of the 50:50 ethanol/water solution was poured into a conical tube. A funnel was then placed in the conical tube and screening material was then placed to the bottom of the funnel. Then a leaf litter sample from Transect 1 was placed into the entrance of the funnel. The funnel was then placed on a ring stand in order to make sure it is held to to the tube containing the ethanol mixture. The base of the funnel was then parafilmed to prevent evaporation of the ethanol. A 40 watt light was then placed above the funnel approximately 2 inches from the leaf litter. Last everything was covered with aluminum foil until analysis the following week.


Identification Table: Image:Invertebrates and Vertebrates Data Table.pdf

  • Because our lab group only recovered one invertebrate from our Berlese Funnel of Transect 1 #s 2-6 on the identification table are organisms found from Transect 4.

Image:Inv.1.jpg Image:Inv.2.jpg Image:Inv.3.jpg Image:Inv.4.jpg Image:Inv.5.jpg Image:Inv.6.png

Plantae and Fungi Lab Notebook Entry 02/12/2016 Image:Plantae and Fungi Data .pdf


Microbiology Lab Notebook Entry 02/05/2016

Data Tables: Image:Microbiology Lab Data.pdf

[[Materials and Methods]] write a brief summary of materials and methods and

Gram Stain First a loop was sterilized over a bunsen burner flame and then cooled in order to pick up a small amount of bacterial growth from the agar plate. The bacteria was then smeared onto a slide and a drop of water was added. A circle was then drawn on the opposite side of the side labeled to mark where the sample was located. The water was then evaporated by passing the slid through the flame using tongs with the bacterial sample face up. Once cooled, a drop of crystal violet was put on top, left to stand for a minute, and then rinsed with water. The previous steps were repeated but with Gram Iodine. Then a drop of 95% alcohol was applied for 15 seconds and then rinsed. The remaining water on the slide was then removed with a kimwipe.

DNA Isolation and PCR Amplification DNA samples were first taken from the agar plates (one with tetracycline and one without) using a toothpick scraped across the bacterial colonies. The primers were then placed in the PCR tube resulting in a total of 20 microliters. The PCR tube was then thoroughly mixed to dissolve the PCR bead. The toothpick was then dipped in the PCR tube and mixed with its contents. The tube containing the DNA sample was then placed in the PCR machine.

No Gram stain tet (+) 10-5 Image:No_Gram_stain_tet_(+)_10-5.PNG‎

No Gram stain tet (-) 10-7 Image:No_Gram_stain_tet_(-)_10-7.PNG‎

Gram stain tet (-) 10-5 Image:Gram_stain_tet_(-)_10-5_.PNG‎

Gram stain tet (+) 10-5Image:IMG_4095.PNG

Gram stain tet (-) 10-7 Image:Gram_stain_tet_(+)_10-5.PNG‎

Gram stain tet (+) 10-7Image:Gram_stain_tet_(+)_10-7.PNG‎

Personal tools