User:Maria Andronicou/Notebook/Biology 210 at AU

From OpenWetWare

Jump to: navigation, search

3/3/2015

16S Sequence

The purpose of the PCR method was used to identify the 16S sequence. This sequence is found in different types of bacteria which grow in our transect. From the petri dishes that were prepared using samples from our transect; to grow bacteria colonies were used in the PCR. The sequence was identified and was place in the Blast website. This website helped us find the identity of the organism which is in possession of this sequence. The two species found were: Bacillus Cereus and Chryseobacterium.


Raw sequences:Bacillus Cereus: NNNNNNNNGGNNGCNANANTGCAGTCGAGCGAATGGNNTGATANCTTGCTCTCNNAANTTAGCGGCGGACGGGTGATTAA TACNTGGGTAACCGGCCGNGGGACTGNCATAACTCCGGGAAACCTGGTATAATACCGGATAANATTTTGAACTGCNGGGT TCGAAATTGCTTGGCCGCTTCNGCTGTCCCTTATGGATGGACCCACNTCGCATTATCTAGTTGGTGANGTAACAGCTCAC CAANGTAACCATGCGTANCCGACCTGANANGGTGATCGGCCACACTGGGACTGANCCACGGNCCAGACTCCTAGGGGAAG CANCANTANGGAATCTTCCCCTGTGGACGAAAGTCTGACGGAGCAACGCCNCGTGTNTGATGAANGCTTTCTNGTCGTAA AACTCTGTTGTTATGGATNAACAAGTGCTAGTTTAATAAGCTGGCACCTTGNNANNACCTNCCCNNAAAGCCGCGGCTAA CTACGTGCTANCAGCCNTGGNAATANNTNTGTGGCAAACTGTATGCCGANTTNTCGCNCGTAANANGGCGTCCCCCGTTT CTTACCTCTGATGGGAACNNNNGGNGNATNTCTNGAGANGTGCANNGNAAAGGGTAANATGNGAGCNA


Chryseobacterium: NNNNNNNNNNNNNNNNNNNNNCAGCCGAGCGGTAGAGANTCTTCGGAATCTTGAGAGCGGCGTACGGGTGCGGAACACNT GTGCNACCTGCCTTTATCTGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAACATATTGATTGGCATCAATTGA TATTGAAAACTCCGGTGGATAGAGATGGGCACGCGCAAGATTAGATAGTTGGTGAGGTAACGGCTCACCAAGTCAATGAT CTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGA ATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGT ATAGGGATAAACCTTTCCACGTGTGGAAAGCTGAAGGTACTATACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGC GGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCNGGGCTCGTAAGTCAGTGGTGA AATCTCATAGCTTAACTATGAAACTGCCATTGATACTGCGAGCCTTGAGTAAGGTAGAGGTAGCTGGGAATAAGTAGTGT ANCGGTGAAATGCATATATATTACTTANAACACCNATTGCGAAGGCAGGNTTACCNTGTCTTAACTGACGCTGATGGACG AAAGCGTGGNGGAGCGAACAGGNNTTAGATACTCCTGGGTAGTCCACGCNNTAAANGATGCTNNNTNCGTTTTTGGGTCT TCNGATTCNNANACTANNNNAAANTGATANNTNAGNCCACCTGGGGGAGTACNTTNNNNANCANTGAANATTNTNACNNN TNGACTGGGGGCCCGCCNCNANCGGNNGNATNANGTNGNTTANTNNNNNNTACGCTGGGNNCNTNNCATGNCTNNNNTGG GAGTNNNNAGNTNGNANNNGACTTTCNTCNNANANNTNTNNTGTNNCNNNCNNGGGNNGGNNNNNNNCNCNNNCCNNNNA NGNNTNGNTNNNNNNNNGCNNNNNNCNN


Bacillus Cereus: Bacillus cereus is an endemic, soil-dwelling, Gram-positive, rod-shaped, motile, beta hemolytic bacterium. Some strains are harmful to humans and cause foodborne illness, while other strains can be beneficial as probiotics for animals. According to our sample found in the petri dish the bacterium was a rod-shaped, motile and Gram-positive, therefore this sequence matches the bacterium which is present in the transect. Chryseobacterium: A yellow-pigmented bacterium, strain had Gram-negative, non-motile, rod-shaped cells.It was strictly aerobic and chemo-organotrophic and grew at 5–30 °C and at pH 5–8.(Shimizunagasaki). The bacteria collected from our second petridish was a gram negative, rod, non-motile bacterium, thus matches the sequence found.

--Maria Andronicou 12:57, 3 March 2015 (EST)MA

4.7.15 Include gel image if possible SK



2/22/2015

Lab 6

Embryology and Zebrafish Development

The purpose of this lab was to learn the stages of embryonic development, compare the different embryonic development in different organisms and to set up an experiment to study how different environmental conditions affect the development of zebrafish embryos. Embryology is the term used to describe the events that occur after the egg has fertilized with the sperm, this events are: growth, differentiation, and morphogenesis. The early stages of embryonic development are similar for both vertebrates and advanced invertebrates. The embryo in early development requires many nutrients and nourishment, this was the function of the egg yolk which has developed into a placenta. (as in mammals the placenta and umbilical cord is what nourishes the developing embryo). The fertilized egg is known as a zygote, at the first cleavage the zygote divides into an Eight-cell stage, in the second cleavage it forms a Blastula (hollow ball), the cells of the blastula migrate to new positions forming three primary germ layers: ectoderm, mesoderm and endoderm. In lab starfish, frog and chick development was observed under a microscope. An experiment was set up to study the effect of different conditions affecting the development of embryos. Zebrafish embryos were used. My partner and I are investigating the effect of nicotine on zebrafish development. A clean petri dish was used to transfer a good amount of zebrafish embryos, from the stock that had arrived on the 19th of February. The zebrafish were placed under a compound microscope. They were found to be between 8-somite and 17-somites embryonic stages. Two other dishes were used to separate 20 healthy zebrafish in each dish. The one dish acts as a control with only 20mL of water in it, the second dish is the experimental one,20 ml of water and 5 ml of 25 mg Nicotine. The dishes were labeled and placed in a closed container to minimize evaporation of liquids. The next day the zebrafish were observed to remove any dead embryos. On the 7th day the lab work required examining the zebrafish and treating them as needed. Dead zebrafish were removed or any other dead material found in the petri dish. 10 mL of water was removed and 10 mL of clean water was added. Survived: 14 still alive in the control dish, 7 alive in Nicotine experimental dish. Dead: 2 dead zebrafish were found in control and removed. Stage: the stage in both petri dishes is 48hrs and more. Movement: in control the response and movement of zebrafish is rapid, there body structure is normal and nervous system is visible and clear, eye size is normal. In the experimental petri dish with Nicotine the response and movement of zebrafish is slower compared to the control, body size is visibly smaller, and some of the zebrafish have an arced back. The nervous system is faded and eye shape is abnormal. Heart beat: in control the heart beat was measured to be 30 beats/min, for the experimental one the heartbeat was slightly increased to 42 beats/min. In conclusion we can observe that nicotine has an effect on the survival of the zebrafish, the body size and shape, the nervous system in general as response is minimized, and eye diameter. Day 11: on this day we were supposed to examine the zebrafish for any dead material or zebrafish and to be removed. In the control petri dish no dead zebrafish were found, thus remain at a number of 14 zebrafish. The response though of the zebrafish is reduced, there is slight movement but the heart beat is stable. For the experimental plate of nicotine no dead zebrafish thus remaining at a number of 7, the body shape is more arched, and there is almost no response, there is slight tail movement at the bottom of the container. Both plates are found on stage of 12 days old. Day 14: This was the last day to make final observations and measurements. The zebrafish in the control petri dish are still all alive; remaining to a number of 14. The experimental zebrafish in the petri dish containing nicotine are also all alive from day 12; thus a number of 7 zebrafish. The petri dishes were placed under the dissecting microscope to observe their movement and body structure. The control show growth of the body and normal response to movement. Whereas the experimental zebrafish show decreased response and increased arc of body shape. The eye diameter, tail length and whole body length was measured and recorded on day 7 and today on day 14. The lengths were used to examine the difference of growth compared to a healthy zebrafish and the experimental nicotine zebrafish. Measurements on day 7 control: Eye --> 42μm (x10) Tail --> 80μm (x4) Body --> 140 μm (x4) Experimental: Eye --> 38μm (x10) Tail --> 75μm (x4) Body --> 138μm (x4) Measurements on day 14 control: Eye --> 55μm (x10) Tail --> 83 (x4) Body --> 155μm (x4) Experimental: Eye --> 42μm Tail --> 80μm (x4) Body --> 138μm (x4) After the this two weeks time of experimental work on the development of zebrafish when exposed to different conditions; we came to a conclusion. The nicotine levels effect the development and functioning of the zebrafish. The zebrafish do not grow as long as healthy once; the body arches and bents thus effecting the length of the body. The eye diameters are smaller compared to the healthy zebrafish thus the nervous system is damaged and response to danger and other predators or toxicity is decreased by the nicotine zebrafish. Lastly the heart rate and pigmentation of the body differs between the healthy and nicotine exposed zebrafish. The healthy once have a stable heart rate and a clearly visible nervous system, thus their bodies are clear pigmented and the black pigmented nervous system is easily distinguished. In the nicotine zebrafish the heart rate is increased as probably the zebrafish is trying to take sufficient amount of oxygen to the brain and to parts of its body that need oxygen to produce energy for movement (especially the tail). The pigmentation of the body has a yellow hue, concentrated mostly in the middle of the body, were the nervous system travels from the head towards the tail (the medulla of the fish) thus this shows that the heart rate and breathing rate is increased as the medulla is the part of the brain in charge of heart rate and breathing rate. The pigmented nervous system is faded at specific areas of the body and not easily distinguished.

--Maria Andronicou 13:44, 20 March 2015 (EDT)MA

4.7.15 Need to present data better, for example in a table. Also images would be good and conclusions. SK


2.23.15 The initial identification of invertebrates is good. The entry would be improved by including some more detail and conclusions. There is no information on Vertebrates found in transect. You also need to include a food web. SK

2/15/2015

Lab 5

Invertebrates


The purpose of this lab is to understand how important invertebrates are and to observe what kind of invertebrates can grow in our transect. The invertebrates are organisms that lack a backbone, eg: earth worms, sponges, octopus etc. In procedure one was to observe Planaria using a dissecting scope. Distinguish their digesting system as they were fed with egg yolk. In procedure two samples of the five major classes was observed: Arachnida, Diplopoda, Chilopoda, and Crustacea. Lastly we examined the invertebrates which grew over the past week in the Berlese Funnel. The tube of ethanol was emptied in a petri dish and placed under a dissecting microscope. Five organisms were found in the petri dish. 1) Three Soil mite (large) which were round in shape and brown in color. 2) Three Ground spiders, white transparent bodies. 3) One Nematode worm, brown long and thin structure. 4) Three Springtails curled and transparent bodies with small legs. 5) Dead insects with wings.

--Maria Andronicou 18:17, 15 February 2015 (EST)MA


2.19.15 Good start but missing some information from the data table eg. mechanism of reproduction. It is possible to make a table in excel, convert it to OWW suitable format in http://excel2wiki.net and then copy and paste it back into OWW. Again, pictures would add to it. SK

2/11/2015 Plantae and Fungi Lab 4

The purpose of this lab is to get familiar with Fungi and Plantae structures of absorbing nutrients, water, gas exchange and reproduce.

  • We had to visit our transect once more to collect about 500g of dead leaves, leaves from the plants growing there, soil and any kind of seeds which could be found. Five transect samples were observed and described.

1) lettuce Vegetable spot, round leaf of 8cm green colored. 2) Kale Vegetable spot, oval and crumbly shaped and folded, whitish green color, ~8cm long. 3) Dead vegetable leaves, shrink to a smaller size of living leaves, change of color to brown. 4) Other dead leaves on ground, larger size therefore must be from trees, brown color. 5) Soil sample,moist and wet, dark brown color.

Vascularization was also observed and compared between the samples collected. Vascularization can be in a scattered pattern or in a ring, with the xylem vessels always situated further in the middle of the stem as it gives protection and turgidity, (xylem vessel carries water), and phloem further out, (phloem carries sugars and food for the plant).

Presence of specialized structures were taken under consideration of the leaves collected. Waxy outer cuticle to prevent water loss, green color due to the green pigment chlorophyll which is in charge of absorbing light. Furry outer layer which also prevents water loss. Wrinkled thus increases surface area to volume ratio thus sufficient gas exchanges.

A lily was observed for the reproductive structure of flowering plantae. Both male and female organs are present on the plant, the male (anther) producing haploid pollen sperms, the female (stigma) which the pollen attaches to, producing a pollen tube leading to the ovary were a zygote (seed) is formed. The lily was dissected and these parts of the reproductive system were identified.

The fungi play a huge role for life on earth. They are major decomposers, their metabolism releases carbon dioxide in the atmosphere and nitrogenouse material in the soil for green plantae to use. The well known "black bread mold" was observed in an agar plate. The white mass of hyphae filaments were at the surface of the agar, the whole hyphae structure is called mycelium. The fungi had black sporangia which hold cells called spores, these spores are the way fungi can travel via wind and grow on other decaying organisms.


Lastly a Berlese Funnel was seated up with the transect samples collected at the beginning of the lab. A conical tube was used to place the neck of the funel inside, the tube contained 25mL of 50% ethanol and 50% water. The funnel was secured on the tube using tape, a stand and clamp was obtained to hold the Berlese funnel under light. The sample was placed inside the funnel and will be left there for a week. This will help us collect invertebrates growing in our transect sample.

--Maria Andronicou 01:53, 11 February 2015 (EST)MA




2.10.15 Missing results from lab. Need to include table with results from serial dilution and bacterial characterization. Also need to include a little more detail about PCR setup. Have a go at including some photographs too. The link to the JPG file didn't work. If you need help with this talk to me or Dr Bentley. SK

2/4/2015

Lab 3 Microbiology and Identifying Bacteria with DNA Sequences

The purpose of lab 3 was to understand the characteristics of bacteria and to identify them. From the previous lab 2 we had created 6 culture plates: 3 containing only agar and the other 3 containing agar and the antibiotic Tetracycline. We observed the growth of the bacteria in the agar plates and recorded data in a table. We observed that there was growth in all the plates except the 10^-9 plate with agar and tetracycline. Mabio210.jpg

We came to the conclusion that the bacteria are resistance to the antibiotic tetracycline as there was major colonies growth on the plates. The colonies can mostly be described as "a lawn", due to there were major growth, the coloring of the bacteria examined was yellow, white or small black spots.

Two procedures were carried out to examine the bacteria using a microscope: 1) Wet Mount Procedure: A sterilized loop was placed into a Bunsen burner flame to kill any bacteria present on it, left to cool for a few second and then was used to scrape some bacteria from the plates. A glass slide was used with a drop of water to place the bacteria scraped from the plate, and covered with a cover slip.The slide was placed under the microscope. We firstly examined the slide with the x10 magnification and then a drop of oil was placed on the cover slip and viewed with the x40 magnification. As the bacteria were not stained it was hard to see them thus the oil was used. The shape and motility of the organism was identified.

2) Gram Stain Procedure:A loop was used again to scrape a sample of bacteria and placed on a glass slide with a drop of water. Tongs were used to place the slide in a flame with the sample facing upwards, to allow the water to evaporate. Working with a straining tray crystal violate was placed on the bacteria smear for a minuted and then rinsed with distilled water. Then Gram's iodine is placed on the smear for one minute and rinsed again. Decolorizing the smear with 95% alcohol for 10-20 second. Lastly cover the smear with with safranin stain for 30 seconds. The slides were examined under the microscope with the same way as described in the first procedure above.


In procedure 3 we seated up a PCR for 16S sequence which will be use for the upcoming lab 4

--Maria Andronicou 21:08, 4 February 2015 (EST)Maria Andronicou



2.4.15 Good notebook entry. Try to include a little more detail on identified protists and some images. Each new entry should be posted at the top of the page so most recent is at the top. SK

1/26/2015


Lab 2 -- Identifying Algae and Protists

In this lab the purpose was to practice how to identify unknowns using a dichotomous key. Also to gain the understanding of the characteristics of Algae and Protists;finally to get the chance to examine the microorganisms that grew in our transect from the previous lab.

Material and Methods:

1) For procedure one we used the ready made slides and observed them using the microscope, measured the organism with the ocular ruler, thus to compare them to the organisms depicted on the dichotomous.

2) For the second procedure we created a wet mount of an unknown organism. By placing a drop of our unknown on a clean slide and covering it with a cover slip we placed it under a microscope and observed the organism and compared it to the dichotomous key.

3) Now we observed the appearance of our Hay Infusion. The water had a brown color, the surface of the water had gel like surface growth with a bad smell and most of the water had evaporated.

4) Two wet mounts were created from our Hay Infusion from two different positions. The one position was from the gel like surface and the other from the bottom of the container. Three organisms were identified from each position. The first slide (gel surface) contained, Chlamydomonas, Paramecium Aurelia and Spirostomum. The second slide (bottom of container) contained, Bursaria truncatella, Colpidiumsp and Didinium Cyst.

5) Lastly we prepared Serial Dilution from our Hay Infusion. 3 tubes were labeled, 10^4, 10^6, and 10^8. 100μl were placed in the first tube and mixed well, then 100μl were taken from the first tube and placed in the second tube and so on for the last tube. After, 3 plates which contained only agar gel were used to transfer 100μl of the solution in the tubes to the plates. 100μl were placed in 3 other plates which contained agar gel and Tetracycline. This process was done near a Bunsen burner, to create an invisible umbrella around the table we worked, this kept any other organisms from entering our plates.A sterile glass spreader was dipped in alcohol and placed to the flame, killing any microorganisms which could affect the growth of bacteria in our agar plates. The bacteria solution from the serial dilution was spread equally around the plate.

The plates will be incubated at room temperature for a week, the bacteria will devide to create colonies of bacteria in the plates which will be examined in next lab.

--Maria Andronicou 14:35, 27 January 2015 (EST)MA



1.27.15 Good first entry. Try to organize entries into: Purpose, Materials & Methods, Data & observations then conclusions. Include a picture of your transect and list the abiotic and biotic features from your transect. SK

1/21/2015

Lab 1 "Biological Life at AU"

Separating the class in five groups of three, one ecosystem found on campus was assigned. My group was assigned ecosystem 4. Each ecosystem was a transect of dimensions 20 x 20 m.The following ecosystem was enclosed by a fence and contained areas were vegetables were grown. By using a 50 ml conical tube we collected 25 ml of soil and the other half was any kind of vegetation found on the transect. A Hay Infusion Culture had to been set up after our sample was collected. A clean plastic jar was used to place 10-12 grams of our sample and mixed wit 500 ml of Deer park water. Lastly 0.1 grams of dried milk was added and mixed for 10 seconds in the jar.

The Volvo-cine Line

At this point we observed a series of cells under the microscope. To prepare a slide, place a drop of the organism on a glass slide and then put a cover slide above it. If organism is extremely motile place a drop of protosol, this will slow down the organism. The first to be observed was Chlamydomonas. This series of cells are unicellular, isogamous and motile alga which could be found in various places especially damp soil, lakes and ditches. This cell is said to be the beginning of the multicellular evolution. Secondly we observed the Gonium, which is a more complex species that leaves in colonies held by a gelatinous matrix. Third and last, the Volvox, this cell represent the top of the Volvo-cine Line. The big amount of cells that make up the spherical Volvox colony vary in size. With the female gamete being larger than the male, this makes Volvox oogamous. As Volvox contains an anterior and posterior pole of cells, and reproductive cells shows that start of specialized cells.

--Maria Andronicou 22:25, 21 January 2015 (EST)MA

Personal tools