User:Leonor Quintaneiro/Notebook/Aulas de BioMol/2010/03/16

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Sequenciação de DNA

Introdução As sequências de genes e mRNAs com que temos vindo a trabalhar foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing

Note que o resultado de uma sequenciação é um electroferograma, que depois é convertido em "As, Cs, Gs e Ts" por um programa informático.



Questões

O que é necessário para fazer uma reacção de sequenciação? Para uma reacção de sequênciação é necessário o fragmento de DNA que pretendemos sequenciar, um primer que é complementar com o fragmento de DNA que pretendemos sequenciar, DNA polimerase e os quatro nucleótidos.

Que cadeia é sequenciada? A cadeia de DNA do primer.

Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação? Porque este método tem como base a terminação da elongação através de didNTP na mistura que se comportam como os deoxinucleótidos, mas que, no entanto, não possuem o grupo hidróxilo 3' necessário para que haja a ligação do próximo nucleótido. A elongação, deste modo, termina.

Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo? ~ A sequênciação não termina no primeiro nucleótido pois na mistura há um número relativo de dNTPs e didNTPs de maneira a que haja elongação antes de haver terminação da elongação por um didNTP. Este processo tem como base a aleatoriedade dos dNTPs usados para a elongação sendo por isso muito importante a abundência dos didNTPs face aos nucleótidos simples.

Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem? Há uma quantidade muito grande de pequenos fragmentos de nucleótidos no início do electroferograma que vão criar uma sobreposição de picos que vai impedir a leitura precisa deste. Por outro lado, no fim do electroferograma possuímos picos muito largos que correspondem a seuquências muito grandes de nulceótidos. Este fenómeno deve-se à terminação aleatória em todas as posição pelos didNTPs que, no início, vao originar fragmentos muito pequeno (paragem logo a seguir ao primer), e que, no fim, vão criar fragmentos muito grandes (paragem muito longe da posição do primer).

O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo? Devo proceder dividindo a sequência primária em várias diferentes, ou seja, utilizando outros primers para ampliar a leitura de certos locais e permitir que sejam legíveis zonas de sobreposição que apareceram na primeira sequênciação.

Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo? Indivíduo 1: TCGTGTTCTATGATCATGAGAGTCGCCG Indivíduo 2: TCGTGTTCTATGATGATGAGAGTCGCCG

Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder? Tendo conhecimento prévio da sequência do gene da beta-globina, precisaríamos apenas de um primer que correspondesse ao início dessa sequência para o conseguirmos sequenciar o gene que pretendíamos. Para sequenciar o mRNA procederíamos a uma transcriptase reversa.


Personal tools