User:Leonor Quintaneiro/Notebook/Aulas de BioMol/2010/03/02

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Next entry

Aula BioMol

Bold textConsidere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Bold textLembre-se que qualquer representações tem subjacente um conjunto de convenções.

Bold textQue moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos? Moléculas de DNA e RNA (a representação mantém o T, não se modifica para U).

Bold textSupondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real. A apresentação em cadeia dupla com as informações das cadeias 5'-»3'

Bold textPoderá esta sequência conter um gene? Justifique a sua resposta. Sim porque contém o codão de iniciação da Metionina. E contém uma leitura aberta

Bold textIndique o resultado da transcrição desta sequência. Mudando a T para U possuiremos uma das soluções e revertendo a ordem da sequência (leitura do fim para o início).

Bold textÉ possível prever que proteína se encontra codificada numa sequência nucleotídica? Como? Sim, iniciando a leitura no codão de iniciação e fazendo a leitura de 3 em 3 nucleótidos.

Bold textA sequência apresentada codifica alguma proteína? Consulte aqui o código genético Met Y R L N K A G Y E A W Stop assumindo que é um código eucariotico.


Bold textQue diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana? Através do código de trancrição bacteriano 11 a sequência inicia-se no UUG, ou seja, inicia-se logo no início da sequência.

Bold textComo poderia saber de que organismo provém esta sequência? Poderíamos saber utilizando o BLAST.




Personal tools