User:Jenna Wiegand/Notebook/Biology 210 at AU

From OpenWetWare
Jump to navigationJump to search

(Days 1-3 are under my name)

Entry 8 3/22/16

Header

  • For the past few weeks we have been working with Zebra fish to determine how abnormal light effects the body length, eye diameter and activity levels.

Purpose

  • The purpose of our experiment was to use Zebra fish as a model species, to look at how the increased exposure of light due to electronics usage effects human sight.

Materials and Methods

  • For our experiment we used 20 zebra fish, 10 that were kept in constant light, 10 of which were kept in cyclical light (10 hours of light, 14 hours of dark). To start, 10 zebra fish embryos were taken out of a large bowl filled with zebra fish embryos and transferred into their own well. The rest of the well was filled with deerpark water. These fish were labeled 1-10 and were kept in constant light for 14 days.
  • The other 10 zebra fish were also put into wells, and their wells were also filled with deerpark water. These fish were labeled 11-20 and were kept in cyclical light (10 hours of light, 14 hours of dark) for 14 days.

Monday through Friday, the fish were checked on, made sure their water levels did not get too low, and fed them brined shrimp. They only started receiving brine shrimp once they had hatched.

  • On day one, the fish were observed to determine which developmental stage they were currently at, this data was then recorded.
  • On days 4,7, and 15, photos were taken of the zebra fish under the microscope and their activity level was determined and was then ranked using an ethno gram. If the fish was dead it received a 0, 100 if it was alive but didn’t move, 200 if it was moving a little, and 300 if it was very active. After this the photos were uploaded to a program called ImageJ to determine the length of their body and size of their eyes. This information was then recorded.
  • On the last day, we fixed 6 zebra fish to give help get a better understanding of what was happening inside their bodies.

Here is a basic diagram of how our experiment was set up:

  • This is the control setup
  • This is the treated setup

Results

  • Overall we found that the zebra fish that were exposed to constant light had a larger body length, eye diameter and were more active.
  • Here is the graph representing the average body length, eye diameter and activity level for 5 pdf:
  • Here is the graph representing the average body length, eye diameter and activity level for 7 pdf:
  • Here is the graph representing the average body length, eye diameter and activity level for 14 pdf:

Conclusions and Future Directions

  • Overall there appeared to be a change in the body length, eye diameter and activity level of the fish that were exposed to constant light. On average the fish that grew up in constant light were larger in body length and in eye diameter, and appeared to be more active. In the future, the continuation of this experiment would be very beneficial towards the research of how extended light exposure affects the zebra fish’s eyes as well as humans. Ideally the experiment would be longer so that it is much easier to tell the differences between body lengths, eye diameter and activity level into maturity. It would also be helpful if there were a way to look at the physiology inside the zebra fish’s eye. This way the effects of extended light exposure can be looked at internally and externally.

JW

Entry 7 3/13/16 Header

  • Today we focused on examining vertebrates on our transect.

Purpose

  • We are figuring out what potential vertebrates could live on our transect and determine how all of the different aspects on our transect interact with each other.

Materials and Methods

  • We just thought about the potential vertebrates living on our transect and then created a food web representing this.
  • Vertebrates that are most likely found in our transect would consist of: black and grey squirrels, robins, cardinals and rats.
  • Black Squirrels
    • Sciurus S. carolinensis
  • Grey Squirrels
    • Sciurus carolinensis
  • Robins
    • Turdus T. migratorius
  • Cardinals
    • Cardinalis C. cardinalis
  • Brown Rat
    • Rattus norvegicus
  • Biotic factors that benefits all of these animals would include the plants, seeds, and berries. They can use these for food and nesting.
  • Abiotic factors that could benefit these animals would include, rocks, and pieces of tarp. These could be used for nesting as well. There are abiotic factors that could hurt the animals though, the amount of cigarette buds on the transect are very bad for the creatures and could cause them to get sick.
  • Community- this transect shows how vertebrates, invertebrates, biotic and abiotic factors all work together to make a successful ecosystem.
  • Trophic Levels- All of the animals found on our transect would be in lower trophic levels, none of them eat meat, all eat either plants, bugs or anything they can scavenge.
  • Carrying Capacity- The amount of animals that can survive on the transect while living comfortably.

Conclusions and Future Directions This is the last time we are working with our transect. After this experiment we now have a full look at everything in our transect and how it interacts with one another.

Here is the food web created: Day 4: 2/3/16

Header:

  • Todays experiment focused on Plantae and Fungi

Purpose:

  • We are trying to determine what types of plants and fungi were found on our property to help us get more descriptive about what our transect has on its land.

Material and Methods

  • We first went out to our transect to collect soil samples as well as to identify different sample plants present on our transect. The samples were then put under a microscope to determine the vascularization, identify specialized structures, and to find mechanisms of reproduction.
  • We then set up a Berlese Funnel to collect invertebrates for next week's lab.

Data and Observations:

  • We found no seeds in our transect because the transect was not in season.

Table One: Characteristics of Plants Collected from the Transect

  • Fungi sporangia can produce spores by mitosis, but in most land plants, this is the site for meiosis and produce haploid spores. They are very important for the continued reproduction of fungi. This picture shown is very distinguishable, it looks like a common mushroom which is probably in the Basidiomycola family. This is the family that most common mushrooms live in and that we can eat on a daily basis.

Here is a drawn representation of the mushroom under a microscope:

Conclusions and Future Directions

  • As of right now, our transect was covered by vascularized plants that all reproduce by seeds and have specialized structures. We couldn't get a perfect representation of everything due to the cold weather. Our next step is to look at the invertebrates present in our transect, from the Berlese Funnel that was set up last class.

JW


Day:5 2/10/16

Header:

  • Today we focused on invertebrates and how to characterize the ones in our transects.

Purpose

  • To determine the types of invertebrates found in our transect, determine the characteristics, and how they could potentially figure out how they effect the ecosystem around them.

Materials and Methods

  • We first trained our eyes on sample anthropods already chosen for us
  • We put 10-15mL of the 50% ethanol solution and organisms the Berlese Funnel into a petri dish, and the rest of it into a second dish. We then looked at it under a microscope, and identified what kind of anthropods were in our transect. We then found their length, how many were in the sample, what type they were, and a description.
  • We then considered what niches the vertebrates in our transect could have lived in.

Data and Observations

  • Table one goes over the three types of invertebrates that we found in our transect
  • The samples from the Berlese Funnel seemed very similar, we were able to find the most invertebrates when we put our samples on a slide and looked at them under a microscope. Once we did this it was easy to identify ant and annelida that were present in our sample.
  • The most common organisms that we found in our leaf litter was the annelida. Three were found in our slide.
  • Vertebrates that are most likely found in our transect would consist of: black and grey squirrels, robins, cardinals and rats.
  • Black Squirrels
    • Sciurus S. carolinensis
  • Grey Squirrels
    • Sciurus carolinensis
  • Robins
    • Turdus T. migratorius
  • Cardinals
    • Cardinalis C. cardinalis
  • Brown Rat
    • Rattus norvegicus
  • Biotic factors that benefits all of these animals would include the plants, seeds, and berries. They can use these for food and nesting.
  • Abiotic factors that could benefit these animals would include, rocks, and pieces of tarp. These could be used for nesting as well. There are abiotic factors that could hurt the animals though, the amount of cigarette buds on the transect are very bad for the creatures and could cause them to get sick.
  • Community- this transect shows how vertebrates, invertebrates, biotic and abiotic factors all work together to make a successful ecosystem.
  • Trophic Levels- All of the animals found on our transect would be in lower trophic levels, none of them eat meat, all eat either plants, bugs or anything they can scavenge.
  • Carrying Capacity- The amount of animals that can survive on the transect while living comfortably.

Conclusions and Future Directions This is the last time we are working with our transect. After this experiment we now have a full look at everything in our transect and how it interacts with one another.


JW

Entry 6: 3/2/16

Genetic Sequence: TGNANGCCNANCGNGTNAGANGANCGNNNTNCTGNGGNANNCTNTGNGNNAGCGNGNTGATACGGGTGCGGAACACGTGTGCAA CCTGCCTTTATCAGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAATATATTGAATGGCATCATTTGATATTGAAAACTCCGGTGGATA GAGATGGGCACGCGCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCAGTGATCTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTG GTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGAC GACGGCCCTATGGGTTGTAAACTTCTTTTGTATAGGGATAAACCTTTCCACGTGTGGAAAGCTGAAGGTACTATACGAATAAGCACCGGCTAACT CCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATCTGTAAGTCAGTGGTGA AATCTCATAGCTTAACTATGAAACTGCCATTGATACTGCAGGTCTTGAGTAAAGTANAAGTGGCTGGAATAANTAGTGTANCGGTGAAATGCATAG ATATTACTTANNAACACCAATTGCGAAGGGCAGGTCNCTATGTTTTAACTGACGCTGATGGACGAAAGCGTGGGGAGCGAACAGGATTANATACC CTGGTNGTNNNNGCCGTANACGATGCTNACTCNTTTTTNGNNCTTCNGATTCAGAGACTAAGCNAAANTGATAGTTAGNCNNCCTGGNGAGTNC NTTCNCAANAATGAAACTCANAAGAANTGACGGGGGNCCCNCNCANCCGTGNATTATGTNGTTTAATTCANNNNNCNNNNGNANCCTTNNCNAC GCTTAANNGGGATTGNGGGGGNTTAGANNNNANNNGTCTCNNCATTTCNANNTTCTNCNNGGGNNGNCGGNGGNTGGTCCCCCNNTGTANGNN NNGGTCAAGNACNNGNNGNNCCCNNT

Sample 1 was identified as Chryseobacterium with an 80% match to the known genetic code. Chryseobacterium is gram-negative, rod-shaped, and yellow-pigmented. It is found in environments in soil, plants. We unfortunately did not have a chance to out own bacteria sequenced so it is possible that this bacteria is not found on our transect. But because it is found in soil and plant environments it is possible that it could be found on our transect.

JW

Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Jenna_Wiegand/Notebook/Biology_210_at_AU&oldid=935609"