User:Ines Sofia Silva Vieira/Notebook/Bio Molec - caderno/2010/04/27

From OpenWetWare

Jump to: navigation, search

TP6

  • [edit] Exercício 1 – Extremidades e ligações

Considere as seguintes enzimas e respectivas sequências de restrição ( o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT

Que característica invulgar tem a sequência de reconhecimento destas enzimas? Estas sequencias têm uma caracteritica especifica, apresentam palindromia. Ou seja, quando se lêem ambas as cadeias no mesmo sentido(5'-3') são iguais.

Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas.

              3'                              5'

Bam HI : -----G GATCC-------

            ------CCTAG                         G------- 

Hae II: ------GG CC--------

      -------CC                                  GG--------- 

Eco RI: ------G AATTC--------

       ------CTTAA                    G------------ 

Bgl II: -----------A GATCT-------

       -----------TCTAG                    A--------


É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por: BamHI? EcoRI? BglII? Sim, é possivel ligar uma molécula de DNA com extremidades cortadas por BamHI a outra com extremidade cortada com Bam HI uma vez que a sequencia é complementar à zona de restrição assim como acontece para a enzima BglII.


Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique. Os fragmentos cortados com BAM HI serão maiores que os cortados com HaeII uma vez que a sequência de reconhecimento da BamH1 é maior e desta forma, é mais provavel encontrarmos a sequencia GG|CC no genoma do que a G|GATCC.


[edit] Exercício 2 – Mapas de restrição As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose. Reveja os conceitos associados à electroforese em gel de agarose e veja um exemplo virtual da sua aplicação em http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html

A que correspondem as bandas azuis no gel? As bandas azuis no gel correspondem a fragmentos de DNA que sofrem migração no gel consoante o seu tamanho após sofrerem restrição enzimática. Assim, os fragmentos maiores migram menos e os menores depositam-se mais tarde.


Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar? Porquê? pleI espera-se 4 e bglI espera-se 3. ple observa-se so 3 e bglI observamos todos os 3. como o gel se encontra muito concentrado não conseguimos separar da melhor forma os 4 fragmentos pois dois deles (os maiores) estao sobrepostos. Que papel tem a concentração de agarose na análise de fragmentos de restrição? Consoante o tamanho dos fragmentos de restrição devemos variar a concentração de agarose. Assim, quanto mais pequenos forem os fragmentos mais concentrado deverá ser o gel uma vez que estes por serem mais leves migram mais correndo o risco de as bandas migrarem para fora do gel. Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo? A determinação do tamanho dos fragmentos no gel de electroforese é feito por comparação com o DNA ladder, contudo este método não é rigoroso. A determinação rigorosa deve então ser feita porm medição da distância entre o ponto de aplicação do DNA no gel e o local onde os fratgmentos se depositam. Uma vez quer a distância percorrida é proporcional ao tamanho do fragmento, iremos construir uma curva de calibração para determinação exacta.

Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê?


Pode corresponder a uma digestão com esta enzima uma vez que observamos 6 fragmentos de tamanhos diferentes e consistentes com as cinco regiões de corte da enzima EcoRI.

Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas: Quantas moléculas de DNA estão na primeira e na última banda observadas no gel?


Como 1 dalton corresponde a 1,66*10^-27g e o DNA lambda tem 32.6*10^5Da,  estão presentes 10^-21g que correspondem a 10^-15ug. Assim existem 10^15 moléculas de DNA em 1ug de DNA. 


Que quantidade de DNA está nas mesmas bandas? Primeira banda 48510 - 1 ug 21227 - x

estão presentes 0.44ug. última banda 48510 - 1 ug 3530 - x estão presentes 0.073ug.


Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:


DNA x EcoRI = 5000 + 3000 + 2000 DNA x HindIII = 5500 + 4500 DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500 Com base nesta informação, construa o mapa de restrição desta molécula.

|----------|-|---|------|

          E H   E


O primeiro fragmento corresponde ao corte feito pela enzima EcoRI(5000), o segundo corte é feito pela enzima HindIII(aos 5500bp) o terceiro fragmento corresponde ao corte feito pela EcoRI de tamanho 1500bp. O ultimo fragmento de 3000bp é feito pela EcoRI.

Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:

uma enzima de corte único - EcoRI(414/418) uma enzima com dois cortes - BccI(264/265 e 406/407); uma enzima que não corta neste DNA - HaeII.

(ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)



[edit] Exercício 3 – Enzimas de restrição, RFLPs (Restriction Fragment Length Polymorphisms) e diagnóstico de mutações As variações de sequência do genoma humano podem resultar na alterção de locais de corte de enzimas de restrição. As bandas polimórficas observadas após a electroforese de amostras de DNA genómico após tratamento com enzimas de restrição (RFLPs) constituíram o primeiro método laboratorial de “impressões digitais” de DNA para identificação de indivíduos em Medicina legal e forense.

Da mesma forma, mutações causadoras de doença podem gerar variações nos locais de corte de enzimas de restrição que permitem um fácil diagnóstico da sua presença.

O gene humano que codifica a beta-globina possui 3 locais de restrição DdeI. A distância entre o primeiro e o segundo local é de 175 bp. A distância entre o segundo e o terceiro local é de 201 bp. Em indivíduos com anemia de células falciformes ocorre uma mutação que anula o segundo local de restrição DdeI.

Represente esquematicamente o gene normal e o gene mutado, indicando as posições relativas dos 3 locais DdeI.

gene normal:|-----|-|

gene mutado: |------|


Proponha um procedimento para diagnóstico desta mutação com base na técnica de PCR. Para diagnosticar a mutação iria proceder a um PCR com uma enzima de restrição que actua no local onde ocorre mutação - DdeI. Assim após uma electroforese iremos verificar quantos fragmentos obtemos. Se for apenas um, o individuo apresenta a mutação.

Represente esquematicamente os resultados que espera observar ao analisar um indivíduo saudável, um portador da mutação (heterozigótico) e um doente (homozigótico). Individuo saudável: dois fragmentos(201 e 175bp) Individuo portador de mutação: um fragmento de 376bp, num individuo homozigotico para a mutação. um individuo com um so alelo mutado iremos obter os 3 fragmentos, é heterozigotico para a mutaçao.


Retrieved from "http://openwetware.org/wiki/BIOMOL_LCS/2010:TP_6"


|}


Personal tools