User:Gabriela Santos/Notebook/GabrielaSantos BIOMOL/2010/03/09

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Entry title

Gene e mRNA A sequência do genoma humano apresentada abaixo provém do cromossoma 11 e contém o gene da beta-globina:


CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG


A seguinte sequência corresponde ao mRNA da beta-globina:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA



Compare as duas sequências (utilize o alinhamento blast online) Que diferenças encontra e qual a sua origem?

  1. A sequência de baixo (que corresponde ao mRNA embora aqui esteja representada como cDNA) corresponde apenas à sequência do gene depois do “splicing”, ou seja apenas contém os exões. A diferença entre as duas corresponde aos intrões que estão presentes no gene e já foram removidos no mRNA. A sequência do DNA genomico contém, a mais do mRNA, também as zonas que flanqueiam o gene do lado 5’ (onde se encontra o promotor, a montante do local de inicio da transcrição) e do lado 3’ é inserida a cauda de adeninas que se encontra, a negrito, após o final da sequencia transcrita.


Onde se inicia a transcrição e porquê?

  1. A transcrição começa no inicio da sequencia indicada ACATTTGCTTCTGACACAA no gene, que corresponde a uma sequência idêntica no mRNA . A (T)ATAAA box está localizada a -30 pares de bases, e corresponde à sequencia onde se dá o inicio da ligação dos factores de transcrição que vão depois recrutar a Polimerase II.


Experimente traduzir ambas as sequências (tradução online). O que sucede e que implicações tem para o processo de expressão génica?

  1. 1ª sequencia:

5'3' Frame 3 H I Y I Y I F S F L T R R F Stop S K Stop G E D Met L R T E V E F S S I L S C K Y F A Y S G D A G R D P S T Y P K A E L W Stop T K L F H F Stop C I N F L F V Stop Stop E N W E N D L Q Y A Y Q A V I P N I T Stop I H L Q R R Met F L V A I C T D G Met G P R D I S Stop R E G Stop G F E V Q L L S Q C Q K S Q G Q V R L S S L R P H P V E P H P R V G Q S T P R S R E G R S Q G W A Stop K S G Q S H L L L T F A S D T T V F T S N L K Q T P W C I Stop L L R R S L P L L P C G A R Stop T W Met K L V V R P W A G W Y Q G Y K T G L R R P I E T G H V E T E K T L G F L I G T D S L C L L V Y F P T L R L L V V Y P W T Q R F F E S F G D L S T P D A V Met G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R V S L W D A Stop C F L S P S F L W L S S C H R K G I S N R V Q F R Met G N R R Met I A S V W K S Q D R F S F F Y L L F I T I V F F C L I L A F F F F L L R N F Y Y Y T Stop C L N I V Y N K R K Y L Stop D T L S N L K K N F T Q S A Stop Y I T I W N I C V L I C I F I I S L L Y F L L F L I D T Stop S L Y I F Met G Stop S V Met F Stop Y V Y T Y Stop P N Q G N F A F V I L K N A F F F Stop Y T F L F I L F L I L S L I S F F Q G N N D T Met Y H A S L H H S K E Stop Q Stop Stop F L G Stop G N S N I S A Y K Y F C I Stop I V T D V R G F I L L I A A T I Q L P F C F Y F Met V G I R L D Y S E S K L G P F A N H V H T S Y L P P T A P G Q R A G L C A G P S L W Q R I H P T S A G C L S E S G G W C G Stop C P G P Q V S L S S L S C C P I S I K G S F V P Stop V Q L L N W G I L Stop R A L S I W I L P N K K H L F S L Q Stop C I Stop I I S E Y F T K K G Met W

2ªsequencia: 5'3' Frame 3 I C F Stop H N C V H Stop Q P Q T D T Met V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L L V V Y P W T Q R F F E S F G D L S T P D A V Met G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R L L G N V L V C V L A H H F G K E F T P P V Q A A Y Q K V V A G V A N A L A H K Y H Stop A R F L A V Q F L L K V P L F P K S N Y Stop T G G Y Y E G P Stop A S G F C L I K N I Y F H C K K K K


  1. Como estamos a falar de transcritos genomicos, a orientação do processo ocorre sempre de 5' para 3'. Podemos observar que na 1ª sequência temos o DNA genomico que não sofreu ainda splicing, ou seja, não foram retirados os intrões, logo os exões não se encontram juntos para dar origem ao mRNA funcional e posteriormente a uma proteína funcional. Apesar da existência de vários codões de Met e Stop, isso não implica que cada um deles corresponda a uma ORF. Nem a uma parte da nossa proteína, neste caso a da beta globina, pois isso vai depender da fase dos intrões. Tal não se passa na 2ª sequencia que corresponde ao transcrito correcto do gene em questão, é um transcrito muito mais limpo, isto é, com muito menor quantidade de codões stop no meio da sequencia e assim permite obter um transcrito funcional do gene (Met V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L L V V Y P W T Q R F F E S F G D L S T P D A V Met G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R L L G N V L V C V L A H H F G K E F T P P V Q A A Y Q K V V A G V A N A L A H K Y H Stop), a partir de uma sequência já sem os intrões e com união dos diferentes exões (transcrição). Os fragmentos de sequencias que se encontram antes e depois dos codões (iniciador e stop) são zonas de regulação, e que permitem a estabilização do transcrito. São denominadas UTR (5’ e 3’) e não contêm nenhuma ORF (sequencia de aminoácidos que começa por Met e acaba num codão stop).


Se estivesse a comparar a sequência de um gene de E. coli e seu transcrito, que diferenças esperaria encontrar? E se fosse de S. cerevisiae (levedura)?

  1. O DNA genomico, correspondente a um gene da E.coli, e o seu transcrito possuem praticamente o mesmo tamanho e tambem sequências idênticas, mas já não é assim no caso da levedura. As bactérias não têm um mecanismo de splicing e os seus genes não possuem intrões, assim o mRNA é transcrito directamente do DNA genomico sem que haja um processo de remoção de intrões. Já no caso da levedura, que é um eucariota, os seus genes têm intrões e existe um mecanismo de remoção destes intrões (splicing) durante o processo de transcrição. Assim, o tamanho do transcrito produzido pelas leveduras é menor que o do DNA genomico correspondente.



As bactérias e leveduras podem ser crescidas facilmente em grandes quantidades, o que permite a utilização destes organismos como "fábricas" de produção de proteínas. Se pretender utilizar estes organismos para produzir uma proteína humana, que aspectos terá de ter em consideração?

  1. No caso de utilizarmos uma bactéria, terá de ser introduzido nesta uma sequencia de DNA em que os intrões já tenham sido removidos, visto que ela não tem a capacidade de remove-los. Ou seja, teria de ser uma sequência de DNA (cDNA) que seja cópia do mRNA, correspondente à proteína que queremos produzir. Deveria também ser adicionado um promotor bacteriano a montante da sequência a ser transcrita, de modo a que a bactéria possa reconhece-la e se inicie a transcrição. Em seguida, a nossa proteína será então produzida pela bactéria utilizando a maquinaria de tradução da mesma. Será também preciso verificar se o código genético utilizado pela bactéria corresponde ao mesmo do organismo de origem do mRNA já que há diferenças na leitura deste por alguns organismos (o código nem sempre é universal). No caso de utilizarmos uma levedura, que é também um eucariota, já podemos usar uma sequência de um gene que contenha intrões, pois a levedura tem a maquinaria necessária para os remover. Mas seria bom usar um promotor que se tenha demonstrado antes que funciona em levedura.



[edit] Sequenciação de DNA [edit] Introdução Estas sequências foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing



[edit] Questões Considere o seguinte resultado de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?


O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?


Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?



Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder?


Se a sequênciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações?


Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano?



Personal tools