User:Eric M. Walters/Notebook/Spring 2012/2012/05/14

From OpenWetWare

Jump to: navigation, search
Cyanobacterial acrylate production Main project page
Previous entry      Next entry

Starting project: examining utility of the acsA+acrylate counterselection method

Jumping ahead to engineering 3HP production without nailing this down isn't the way go about it. Need to figure out the numbers for how effective this method is. Gonna insert the random barcode sequence TCGTGTACAGGTAGACCGGGCATGCCTTCGTAATAAGGAT between the acsA-up & -down regions, knock it out

  • Ordered primers:
    • acsA-dnF-XbaI CCC TCTAGA GCGCTCAAGTTGATCGAATGTATG
    • acsA-dnF-BCback-SphI CCC GCATGCCTTCGTAATAAGGAT GCGCTCAAGTTGATCGAATGTATG
    • acsA-UpR-BCfront-SphI CCC GCATGCCCGGTCTACCTGTACACGA GTTCGTTTCAATGAAGGCGAAAC
    • ΔacsA-barcode-F AACTCGTGTACAGGTAGACCG



Personal tools