User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2013/11/15

Cell Fate Switch with Synthetic Transcription Factors

Main project page Next entry

Entry title UPLassay This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences. Reaction List REACTION LIST   Template cDNA Gene Target Rxn 1: treated cells PDX1 Rxn 2: treated cells MAFA Rxn 3: treated cells GLP1R Rxn 4: treated cells PCSK1 Rxn 5: treated cells IAPP Rxn 6: treated cells KCNQ2 Rxn 7: treated cells GAPD (reference gene) Rxn 8: untreated cells PDX1 Rxn 9: untreated cells MAFA Rxn 10: untreated cells GLP1R Rxn 11: untreated cells PCSK1 Rxn 12: untreated cells IAPP Rxn 13: untreated cells KCNQ2 Rxn 14: untreated cells GAPD (reference gene) Rxn 15: no template PDX1 Rxn 16: no template MAFA Rxn 17: no template GLP1R Rxn 18: no template PCSK1 Rxn 19: no template IAPP Rxn 20: no template KCN2Q Rxn 21: no template GAPD (reference gene) Run 3 Each 45 Reactions Run Using Variation 2 Variation 2 Using as Reference, discount gene names on left side Primers Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3 PRIMERS LIST   Roche Name Left Primer Right Primer UPL probe PDX1 NM_000209.3 aagctcacgcgtggaaag gccgtgagatgtacttgttgaa #78, cat.no. 04689011001 MAFA NM_201589.3 agcgagaagtgccaactcc ttgtacaggtcccgctcttt #39, cat.no. 04687973001 GLP1R NM_002062.3 gtggcggccaattactactg ggccagcagtgtgtacagg #22, cat.no. 04686969001 PCSK1 NM_000439.4 caagagcttgtgaaggacaaga tctttcagccaagagcacag #1, cat.no. 04684974001 IAPP NM_000415.2 ttaccaaattgtagaggctttcg ccctgcctctatacactcactacc #77, cat.no. 04689003001 KCNQ2(4) NM_172108.3 gacgtcatcgagcagtactca cccacgatctggtccact #56, cat.no. 04688538001 GAPD (Ref) NM_002046.3 agccacatcgctcagacac gcccaatacgaccaaatcc #60, cat.no. 04688589001