User:Charlotte E. Vogler/Notebook/Bacterial DNA Sequencing on 7/22/14

From OpenWetWare

Jump to: navigation, search

Search this Project

Customize your entry pages

Introduction, Purpose, and Objectives

We ran PCR reactions earlier in the summer in order to determine what type of bacteria was present in our transect. Unfortunately, the DNA in our reaction did not come back with any results. This is most likely due to an error in the procedure in which we did the reaction. However, we were able to use a DNA sequence from a similar transect (transect 2) which is likely to hold the same species of bacteria as our transect. Our purpose was to identify the species of bacteria found in transect 2.

Materials and Methods

After the PCR reaction for 16S was complete, it was sent to another laboratory to determine the DNA sequence of the culture.

Results

Unfortunately, the DNA in our reaction did not come back with any results. Instead, we decided to use the DNA sequence from a culture from transect 3, which has a similar ecosystem as transect 2.

The DNA sequence for transect 3 was:

AAGATTAATACCCCATAATATTTTAAGTGGCATCACTTGAAATNGAAAACTCCGGTGGATAAAGATGGGCACGCTCAA GATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGATCTTTAGGGGGCCTGANAGGGTGATCCCCCACACTGGT ACTGAGACACGGACCANACTCCTACGGTAGGATCAGTGAGGAATATT

We used the website [[1]] and chose nucleotide blast in order to search a nucleotide database using a nucleotide query. From here, we entered the sequence and found the bacterial organism that had the closest matching DNA sequence: Chryseobacterium. Chryseobacterium is a gram-negative bacterium and is most often found in soil and common fertilizer. The most likely explanation for it's appearance on AU's campus is that it was added via fertilizer. It is likely that this bacterium found in transect 3 was also present in our ecologically similar transect, transect 2. In past spring sections, both Chryseobacterium and Streptomyces were found in transect 2. Streptomyces is unique to our transect, but Chryseobacterium is clearly common in many areas on campus. Streptomyces is gram-positive and found predominantly in soil and decaying vegetation, which are two of the main components of transect 2.

The spring section information was found here: [[2]]

Personal tools