User:Bayadir Mohamed-Osman/Notebook/Biology 210 at AU

From OpenWetWare

Jump to: navigation, search

Results for Zebrafish

Preliminary Experimental Group Wells Water Nicotine Ratios Rows Water Nicotine Total Amount A 1.5 0.5 2.0 uL B 1.0 1.0 2.0 uL C 0.25 1.25 1.50 uL ** D 0 2.0 2.0 uL Table 1: This table shows how the experimental group wells were set up. The four rows had different variations of water and nicotine solutions. The ** in Row C represents the a mathematical mistake that was made with the solution, which should have been 2.00 uL.


1st Observations- Monday February 22, 2016 General Description Control Group: • curled tail • very developed • pointy tail • eyes apparent • no nicotine presence • Stage 48hrs appearance Table 2: The first observation shows the embryos fully developed into zebrafish. This control group shows the expected characteristics of the zebrafish.

Experimental Group Survival/Growth Description A Very developed Nicotine seems not have had significant influence B Stage 36 hrs appearance Eyes apparent, All in this row generally look the same C Some in 24 hrs appearance stage Others in 28 hrs appearance stage Not as developed in contrast to row A and B D Most are 17 somite appearance Not as developed, the least developed Table 3: Nicotine has an impact on the growth stages of zebrafish. The growth decreases as concentrations grows, specifically Row D grew the least due to the higher concentration of nicotine.

2nd: Observations - Wednesday, February 24, 2016 General Description Control Group: • All look the same • Eyes, tail pointed, straight • Movements Table 4: Second week control zebrafish are all fully grown at a uniform level with movements.


Experiment Group Survival/Growth Description A Most alive Movement, colors: yellow, green, black, bold B Some alive Yellow green C Only about 2 alive, 1 is not even fully grown yet (still in its shell) Most are very thin and dull D 4 fully developed (color and all features) but one is not 4 fully developed (color and all features) but one is not Table 5: There is a variation between each wells growth. As nicotine concentration increases, the development is less.

3rd: Observations - Friday, February 26, 2016 Control Group Description Survival Ocular Space (at 1 Lense) Ocular Measurements (x100) Row A ~8 alive because some wells have more than 1 26 ocular spaces 2600 Row B ~5 alive 26 ocular spaces 2600 Row C ~4 alive 26 ocular spaces 2600 Row D all alive 26-27 ocular spaces ~2650 Table 6: Overall observations consist of zebrafish movement such as quick jumps, most are alive, and full development including eyes apparent. Also, most were at a consistent 26 ocular spaces.


Experimental Group Description Survival Ocular Spaces: (at 1.0 Lense) Ocular Measurements (x100) Row A 5 Alive/6 Wells 28 ocular spaces 2800 Row B 4 Alive/ 6 Wells 26 ocular spaces 2600 Row C 3 Alive/ 6 Wells 25 ocular spaces 2500 Row D 3 Alive/ 6 Wells 21 ocular spaces 2100 Table 7: Based on above results size of the zebrafish decreased from 28 ocular spaces to 21 ocular spaces. Also, survival has begun decreasing.

4th: Observations - Monday February 29, 2016 Description Control Group • All Alive • How many missing: 2 • How many not moving: 8 • Overall slow response, thinner • Most between 35-50 (x1 ocular lens) Table 8: The zebra fish begin slowing down, but all are still alive.

Experimental Group Missing Exploded (life-less) (with SIZE x1 Ocular Space in parentheses) Ocular Measurement (x100) Body Together, but life-less Ocular Measurement (x100) A 1 2 (~35) -> 3500 3 (~35) 3500 B 1 (maybe more b/c explosions unclear) 2 (~20) -> 2000 3 (hardly developed-1 is still in bag )(~ 25) 2500 C 1 3 (~10) -> 1000 2 1000 D 4 1 (~10) -> 1000 1 1000 Table 9: Firstly, the size decreases from 35 ocular spaces to 10. Also, a few more were deformed and life-less in Row D compared to Row A.

5th: Observations - Wednesday March 2nd, 2016 Survival Control Group Experiment Row A - 5 left All dead in all rows! Row B - 4 left Row C - 5 left Row D - 4 left Table 10: By this observation it was apparent all of the zebrafish in nicotine are dead and control group wells had about 4 alive.

6th/Last: Observations - Friday March 4th, 2016 Control Group and Experimental Group: Rows Ocular Space (with .80 lens)

Description: All Dead except 1 Ocular Measurements (x80) Control A ~21-22 (1 alive) 1680 Control B 25, 23 1920 Control C 22 1760 Control D 21 1680 Experimental A- D ~25 most exploded, deformed or unable to find them, size/measure, unclear shape 2000 Table 11: By this day all died and the control zebrafish remained between 21- 25 ocular spaces. Also, the experimental zebrafish are deformed and unclear.




Vertebrates and Food Web

Five vertebrates that may inhabit the transect are deer, rates, lizards, Eastern bluebird, and eagle. They are included in the food web and their classifications are also, included in the image.

Image:FoodWebBay.jpg

Furthermore, the biotic characteristics are the other organisms that live in the transect (that may end up eating each other). Also, the other organisms may cause competition for food. The abiotic factors include weather and sunlight. Some vertebrates require a certain amount of sunlight to survive and may not be able to prosper in cold weather. Carrying capacity is maximum amount of individuals of a species that can survive in a niche. Small transect like this one has limited about resources and space for them, so there has to be a cap amount of vertebrates in this transect. However, even though there is maximum amount, these organisms are still able to live together in this community. They are able to share and live around each other. Furthermore, when living in a community, each individual knows their place in the food chain, which is their trophic level. The food chain is able to create unity, and maintain a flow in the ecosystem.


Updated PCR Sequencing:

Our specific set of gel did not work, however a sample was provided from instructor with the primers MB10 and MB11. The information below is the results.

Results

Sequence File : 5MWP-16s_Forward.seq

For MB11 Primer Forward Sequence is >5MWP-16s_Forward_G11.ab1 NNNNNNNNNNNNNNNNTNGCNNNGCAGTCGNNNNNNNNNGNNAGGNNNNNNNCTTGCTGCTTCGCTGACGAGTGGCGGAC GGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAA GACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCA CCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAG GCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTA AAGTACTTTCAGCGGGGAGGAAGGCGATGTGGTTAATAACCACGTCGATTGACGTTACCCGCAGAAGAAGCACCGGCTAA CTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTC TGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGGCAGGCTTGAGTCTCGTAGAGGGGG GTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAANGCGGCCCCCTGGACGAAGAC TGACGCTCANGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTTGG AGGTTGTGCCCTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAGTCGACCGCCTGGGGAGTACGGCCGCAANGTTAAAAC TCNNTGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCNATGCAACGCGAAGAACCTTACCTGGTCT TGACATCCACAGAACTTNNNCAGANATNGNNNNGGTGCCNTTNNGGAACTGTGANACAGGTGCTGCATGGNTNNCGTCAG CTCGTGNTNNTGAAANNNNN

The results present a 98% match for salmonella bongori strain SL18 16S ribosomal RNA gene, partial sequence.

For MB11 Primer Forward Sequence is: Sequence File : 3MWP-16s_Forward.seq >3MWP-16s_Forward_F11.ab1 NNNNNNNNNNGNAGCNNNNNNNNAGTCGAGCGCCCCGCAGGNNAGCGGCAGACGGGTGAGTAACGCGTGGGAACGTACCT TTTGCTACGGAATAACTCAGGGAAACTTGTGCTAATACCGTAGGTGCCCTTCGGGGGAAAGATTTATCGGCAAAGGATCG GCCCGCGTTGGATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGACTATCCATAGCTGGGCTGAGAGGATGATCAAC CACACTGGGACTGAAACACGGCCCANACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATC CATCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTCACCGGTGAAGATAATGACGGTAACCGGAGAA CAAGCCCCGGCTAACTTCGTGCCAACAGCCGCGGTAATACGAAGGGGGCTAACGTTGTTCGGATTTACTGGGCGTAAAGC GCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTTTGATACTGGAAGTCTTGAG TATGGTANAGGTGAGTGGAATTCCGAGTGTANAGGTGAAATTCNTANATATTCNGAGGAACACCAGTGNNGAANGCGGCT CACTGGACCATTACTGACGCTGANGTGCNAAAGCGTGGGGAGCAAACANGATTANATACCCTGGTAGTCCACGCCGTANA CGATGAATGTTAGCCGTTGGGGAGTTTACTCTTCGGTGGCGCAGCTAACGCATTAAACATTCCGCCTGGNGAGTACNGTC GCAAGATTAAAACTCANANGAATTGACNGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCNAANCAACGCNCAAA CCTTACCANCCCTTGACATACCGGTCGCGGACACAGANATGTGTCTTTCANTTCNNCTGGACCGGATACANGTGCTGCAT GGCTGTCNTCANCTCGTGTCNNGAGATGTTGNGTTAAGTCCCNGCAACGANCGCAACCCCTCNNCCTTANTTGCCAGNNT TTANNTGGNCACTCTANNN

The results present a 98% match for uncultured bacterium clone HDB_SIOT1001 16S ribosomal RNA gene, partial sequence.

Discussion Using the bacteria we characterized they can be compared to these results of salmonella bongori strain and uncultured bacterium clone in order to see if our characteristics match theirs. According to research, salmonella bongori strain is gram negative, motile, and rod-shaped (Wang CX, 2016). Based on our data on the four bacteria plates, the 10^-5 tetracycline plate was gram negative and circular, so our characterization is partly cohesive. Furthermore, uncultured bacterium clone research provided information to uncultured soil bacteria, which is found in soil just like how our samples were from the soil. Also, they are known to have tetracycline resistance and in this experiment tetracycline was used to test the resistance (O'Connell, 2004).In the experiment, both tetracycline plates bacteria colonies grew on them. There is a correlation between our results using tetracycline and agar plates and the PCR sequencing results of uncultured bacterium strain.

References

O'Connell, D. (2004). Pay dirt. Nature Reviews Microbiology, 2(10), 772-772. http://dx.doi.org/10.1038/nrmicro1019 Wang CX, e. (2016). Complete genome sequence of Salmonella enterica subspecies arizonae str. RKS2983. - PubMed - NCBI. Ncbi.nlm.nih.gov. Retrieved 4 March 2016, from http://www.ncbi.nlm.nih.gov/pubmed/26203341

Week 6 Invertebrates

Introduction/Objective of Lab The objective of this lab is to identify the invertebrates from our transect sample using a Berlese Funnel and describe them based on motility and symmetry. The options of symmetry consist of bilateral symmetry, which more complex, and radial symmetry, which is an exact reflection. Invertebrates also, have multiple layers of skin; endoderm, mesoderm, and ectoderm.

Methods and Materials The Berlese Funnel was set up a week prior so, it was taken apart this week. The top of 10-15 mL of 50% ethanol and organisms were poured into two petri dishes in order to be examined using microscope. The identifications was done using the sources given in the classroom.

Results

Image:invert1.jpeg Image:invert2.jpeg Image:invert4.jpeg


Discussion Most of the invertebrates found are arthropods. They were mostly bilateral, brown, had shorter legs, and all were 1-4 nm. Based on the samples it can be concluded there are diverse insects, but not invertebrates in general. The insects found include fleas, chewing/sucking lice, termites, and ticks. This data represents the general scope of transect 2, since the leaf litter was collected from different areas in transect.


== Week 5 Plants and Fungi

==

Introduction/Objective of Lab For this experiment leaf litter was collected from the transect in order for the different characteristics of the plants there, such as presence of vascularization or specialized structures, and the mechanisms of reproduction, can be studied. Using the diagrams and information provided, the leaves can be identified. Vascularization in plants refers to the way the plant is supplied with nutrients and water runs through the roots and stem. Also, when studying plants, the two life cycles are gametophyte (haploid) and sporophyte (diploid) so, the plant is in either of these. The specialized structures are used to retain moisture and allow exchange of oxygen and carbon dioxide. These characteristics will be helpful in identifying whether the leaves are bryophyte or angiosperm. Angiosperms are sporophytes and can spread their gametes through wind. Furthermore, bryophytes are in the gametophytes majority of their life cycle and are simpler since they are same of the earliest plants. Also, observing separate fungi will be able to be used as a comparison. Overall this lab’s objective is to observe and characterize the plants in the transect.

Methods and Materials The process began by collecting five plants from different parts of the transect, observing them using microscopes, and using the lab material information to characterize them.

Pictures at the scene with a description of where found--- Image:transectleaves.JPG

Another observation was done with fungi, which was helpful practice. Also, leaf litter and plant matter were collected in order to create a berlese funnel to collect invertebrates. 25 mL of ethanol and water solution was added to a conical tube. Inside the funnel a screen was added and the leaf litter. The tube was connected to the bottom of funnel and all of it was placed about 1-2 inches underneath a 40 watt incandescent lamp and all were covered underneath foil.

Results

Picture of the fives leaves-- Image:IMG_1651.jpg

Example of how they looked through microscope-- Image:IMG_1638.jpg

Table 1: Image:Table1Bayadir.jpg Image:Table2Bayadir.jpg

Observing the Fungi: Image:IMG_1655.jpg


Discussion The table shows this transect is filled with dicots so, it can inferred all these leaves are angiosperms. They are dicots because their pattern of vascularization is significant, which were veins running through middle as the images above show. Also, they have specialized cells such as stomata that transmits and brings in gases and water vapor. These leaves were collected from different parts of the transect, however they all have similar vascularization and mechanisms of reproduction are similar, so it can be concluded their ancestors relate. But on the other hand, their specialized structures, their size, color, and texture of the leaves were diverse. Angiosperms have the ability to spread their gametes, which are their pollen, through wind borne mechanism and this ability is a factor in why this transect has a substantial amount of angiosperms. Furthermore, the mushroom that was studied in the lab is a basidiomycota because of the life cycle and the structures it contained. It is a fungi because it has hyphae strands growing on it and the overall white growth is called mycelium. It is important to study fungi because they are decomposers and heterotrophic.




== Microbiology and Identifying Bacteria Week 4 == == Introduction/Objective of Lab ==

I began this week’s lab by examining the Hay Infusion Culture one more time. It smelled worse than previous week; there were extra white layers that grew. The water got also, got darker and less clearer. It is probably changing throughout the weeks because more organisms are growing and breeding. I do not expect archae to have grown in jar because they grow in extreme conditions.

Image of Hay Infusion now: Image:IMG_1536.jpg

The point of this lab is to identify the species of bacteria based on observations (such as colony morphology), motility, gram stains, and gene sequencing. Bacteria’s shapes include bacillus, coccus, and spirillum, which can be observed using a microscope. Also, the number of colonies, shape, surface, gene sequences, and elevation level differ.

Materials and Methods First observations of agar plates were made by estimating the number of colonies. Also, wet mounts were observed of four of the six samples. Gram stains were made, which determine whether or not the bacteria has peptidoglycan in cell walls. Gram stains can either be gram-negative or positive. The sample is placed on slide with crystal violet poured on to slide for a minute, then rinsed with water. Also, gram’s iodine and 95% alcohol are individually poured for a minute and finally water to clean the excess. The gram stains were then observed/magnified using microscope. In order to prepare for next week’s lab one of each plates of the two categories were picked for PCR in order to amplify the 16S rRNA gene. The two tubes were labeled, 20 ul of water and primer are added in order to dissolve PCR bead, and a speck of the sample was added using a toothpick. Next week they will be examined using agarose gel.

Results


Table 1 Image: Image:File_000(1).jpeg Image of the 6 plates (Tetra on bottom row): Image:sixplates.JPG

Table 2 Image: Image:File_001.jpeg

Table 1 results shows the most diluted had less colonies on plate, but that is reasonable. The tetracycline seems like it causes more colonies. The nutrients only plates had two types of organisms growing since there were two colors for colonies. Also they had majority circular, irregular colonies that could easily be counted. However the tetracycline had lawns that were closely connected, specifically, punctiform which are harder to count. Table 2 includes data collected after gram stains, which included if they are positive or not, color, and the cell description. When it comes to gram stains three out of four were gram-positive, which means they retained the dye since they were stained blue and they have pepticloglycan in walls.

These images are the drawings of the four wet mounts we observed of 10-9 and 10-5 nutrient and tetracycline plates. (2 images)

Image:File_003.jpeg Image:File_002(1).jpeg



These images are from microscope that helped us fill out Table 2. (4 images)

10^-9 Nutrient Agar Plate Gram Stain Image:IMG_1513.jpg

10^-9 Tetracycline Nutrient Plate Gram Stain Image:IMG_1521.jpg

10^-5 Tetracycline Plate Gram Stain Image:IMG_1525.jpg

10^-5 Nutrient Agar Gram Stain Image:IMG_1532.jpg



Discussion A hypothesis I have is tetracycline plate has only one kind of colony growing because the antibiotic prevents bacteria from growing. The biggest difference is 10-9 plates; the tetracycline plate has significantly greater number of colonies compared to nutrient only. The bacteria that grew in the tetracycline plate shows antibiotic-resistance. Tetracycline controls gram negative and positive bacteria, chlamydiae, mycoplasmas, rickettsiae, and protozoan parasites are sensitive to tetracycline (http://mmbr.asm.org/content/65/2/232.full#sec-3).

This lab is important because bacteria species range based on different characteristics and we should be able to differentiate the different kind of bacteria. The differences and similarities can be studied to conclude phylogenetic relationships. Furthermore, identifying the bacteria in hay infusion allows us to learn more about the transect we gathered from.








== Protists and Algae Week 3 ==


Introduction/Objective of Lab


The 500 mLs Hay infusion was set up using transect #2 including dirt, water, and leaves. Even though it was all in one container; there are different types of niches in this ecosystem. After a week of it soaking in a jar the water was moldy and brown. The dirt appeared to be sandy; there was apparent life with the mold stuck on the sides. It smelled rotten. The objective of this lab is to determine what organisms exist in the Hay Infusion Culture.

Image:IMG 1350.JPG Image:IMG_1351.JPG

Methods/Materials We began by taking a sample from the bottom, then middle, and also from the top of the jar. The samples were used to make wet mounts in order for them to be observed using a microscope. Image:labbio.jpg Image:miclab.jpg


Image:IMG 1352.JPG Image:IMG_1354.JPG Image:Image2.jpg


Results The protists were identified using observation and a dichotomous key by observing size, shape, color, and mobility. The organism found in the top and middle was a protozoa peranema. They were colorless, exhibited motion, flagella like end, and had single cells inside. This information was collected using a dichotomous key and its estimated length is about 20-70 um. The bottom however, was different because chlamydomonas algae was found. It was grass- green, had flagella, solitary cells, and had a chloroplast. The length is estimated to be 5-12 um.


Image of Peranema: Peranema Image of chlamydomonas

Conclusion of this lab:

I predict if the Hay Infusions grew for another two months the concentration of the algae and protists would be higher. The water would be darker and more would grow in most spots of jar. Also, where the jar is stored will affect the conditions inside. The introduction to next week’s lab is a serial dilution.

-a diagram of serial dilution procedure-


Image:dilutionslab.jpg









Search this Project

Customize your entry pages

== Transect#2 Description Week 2 ==

Introduction At transect number 2, near the amphitheater, there was a stream that had pebbles, trees, and bigger rocks. In the image, I included the trees especially the tree over the river. Also, I included where we picked our samples from, different areas from river. The objective of the lab is to examine the transect.

Materials/Methods We just drew an image of the transect with labels. Also, collected leaves and dirt from different areas in plastic bags. They were added in a jar with water and dry milk in order to make a hay infusion culture that will be studied in weeks to come.

Results

Image:File 006.jpeg

Abiotic components: The temperature was cold, about 30 degrees, the moisture in the soil was most likely due to the stream. Also there was sunlight.The most apparent component was the stones and rocks. They were different colors, had green, assuming algae on them. Biotic components: There were different types of trees and bushes; mostly in the outside. They did not have leaves on them though. I did not see any animals or bugs around.

Image:File 002 Image:File 000

Conclusion I predict what is going to be very diverse because many different components intertwine to create the ecosystem of transect #2.

Notes

  • Place some notes here for visitors
  • Example: This project is currently on hold until further notice.


Recent changes



Personal tools