User:Ana Matos/Notebook/Aulas de BioMolecular/2010/04/20

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Aula 5

PCR e RT-PCR

Introdução

A técnica do PCR permite obter um grande número de cópias de uma sequência de DNA de interesse a partir de uma quantidade mínima de material. Nas aplicações de maior sensibilidade, uma única molécula de DNA pode ser suficiente para gerar milhões de cópias. Este é por issoo método base para um número muito grande de técnicas de diagnóstico molecular, incluindo em particular os diagnósticos que requerem sequenciação de DNA.

A seguinte animação explica o funcionamento da técnica: PCR

Quando é necessário proceder à caracterização da expressão de genes, é também possível aplicar a técnica de PCR acoplando-a a uma reacção de transcrição reversa, como explicado na seguinte animação: RT-PCR

Note que o resultado de um ensaio de PCR ou RT-PCR tem geralmente de ser visualisado por separação electroforética dos produtos de reacção.



Questões

Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo. O meu objectivo neste procedimento será sequênciar o gene da beta-hemoglobina mutado para depois comparar com o gene normal, vendo assim as diferenças presentes (mutações).

Procedimento experimental:

1. Design do par de primers que permitam a síntese da região do gene que é transcrita por PCR:

 a.	LEFT primer: CATATTCTGGAGACGCAGGA
 b.	RIGHT primer: TGCTCAAGGCCCTTCATAAT

2. Recolha da amostra biológica - esfregaço de células da mucosa bucal

3. Hidrólise ácida das células para obtenção do DNA

4. Preparar mix para PCR:

 a.	Amostra de DNA
 b.	2 primers
 c.	Taq polimerase
 d.	dNTPs
 e.	Solução tampão
 f.	Água

5. Realizar PCR e fazer uma electroforese

6. Purificação do DNA, obtido no PCR, para eliminar as sequências correspondentes aos primers

7. Design dos primers que permitam a sequenciação da região do gene que contém as mutações:

 a.	CATATTCTGGAGACGCAGGA (5’ → 3’)
 b.	TGTACACATATTGACCAAATCAGG (5’ → 3’)
 c.	ATGGGACGCTTGATGTTTTC (5’ → 3’)
 d.	GGCATAAAAGTCAGGGCAGA (5’ → 3’)

8. Preparar mix para sequenciação:

 a.	DNA template
 b.	Primers
 c.	DNA polimerase
 d.	dNTP (A, T, C e G)
 e.	ddNTP

9. Análise dos resultados – comparar os resultados da sequenciação com a sequência de referência (BLAST)



Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.

Para estudar a expressão do gene poderá recorrer-se à técnica de RT-PCR. Pela acção da enzima transcriptase reversa, a partir do mRNA, presente em cada indivíduo, obtém-se cDNA, que é estudado quantitativa e qualitativamente, comparando sequências obtidas com as sequências sem mutação.

Procedimento experimental:

1. Design dos primers para a reacção de RT:

 b.	RIGHT primer: CTTTCTTGCCATGAGCCTTC

2. Recolha da amostra biológica - sangue

3. Lise dos eritrócitos para obtenção do RNA (e sua preparação)

4. Preparar mix para reacção de RT:

 a.	RNA desnaturado
 b.	Solução tampão
 c.	dNTPs
 d.	MgCl2
 e.	Primers
 f.	Transcriptase reversa
 g.	Água

5. Design dos primers para a reacção de PCR:

 a.	LEFT primer: TCTGTCCACTCCTGATGCTG
 b.	RIGHT primer: CTTTCTTGCCATGAGCCTTC

6. Preparar mix para PCR:

 a.	cDNA
 b.	Solução tampão
 c.	Taq polimerase
 d.	2 primers
 e.	dNTPs
 f.	Água

7. Realizar PCR e fazer uma electroforese

8. Análise dos resultados


[edit] Nota: Se quiser incluir detalhes práticos sobre as reacções, consulte: Protocolo Taq polimerase Protocolo Transcriptase reversa



Personal tools