User:Ana Matos/Notebook/Aulas de BioMolecular/2010/03/09

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Aula 2

*Gene e RNA

A sequência do genoma humano apresentada abaixo provém do cromossoma 11 e contém o gene da beta-globina:


CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG


A seguinte sequência corresponde ao mRNA da beta-globina:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA



Compare as duas sequências (utilize o alinhamento blast online)

Que diferenças encontra e qual a sua origem? O RNA é partido em 3, logo há 3 pedaços no DNA que codificam esse RNA. Nesse caso há pedaços do DNA que não são codificantes da proteína. O DNA ainda tem intrões, que não são transcritos para o RNA, e são esses intrões maioritariamente que formam os pedaços que não são codificantes (isto porque além de intrões existe os promotores e enhencers por ex.). O DNA corresponde aos fragmentos do RNA em 100% de igualdade excepto na cauda poli-A que corresponde ao fragmento "AAAAAAAAA" que só existe no mRNA.

Onde se inicia a transcrição e porquê? Vou dar o exemplo do fragmento de RNA que começa com "ACATTTGCTTCT". O nucleótido 1 do RNA corresponde ao nucleótido 546 do DNA, logo é no nucleótido 546 que se inicia a transcrição. Ao contarmos 25 nucleótidos para trás(direcção contrária à transcrição) encontramos a TATAbox, que neste caso é ATAAAA. No iniciador temos TTATTTG, sendo TT as duas pirimidinas, A o nucleotido iniciador, T é o nucleótido qualquer, T é a escolha entre T e A e TG são as outras duas pirimidinas.

Experimente traduzir ambas as sequências (tradução online). O que sucede e que implicações tem para o processo de expressão génica? O DNA ao ser traduzido não têm sequencias codificantes, apenas dá sequencias sem sentido, quando é transcrito para RNA é que codifica proteínas. Isto porque o DNA tem intrões. O RNA por outro lado tem uma sequencia que provavelmente corresponde à hemoglobina: frame 3 5'->3' a sequencia Met V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L L V V Y P W T Q R F F E S F G D L S T P D A V Met G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R L L G N V L V C V L A H H F G K E F T P P V Q A A Y Q K V V A G V A N A L A H K Y H Stop. Mesmo o RNA não é totalmente codificante, existem as regiões não codificantes que têm funções importantes.

Se estivesse a comparar a sequência de um gene de E. coli e seu transcrito, que diferenças esperaria encontrar? E se fosse de S. cerevisiae (levedura)? E.Coli é um procariota e S.cerevisiae um eucariota. Os procariotas não têm intrões no seu genoma, logo a transcrição é "directa" e o seu transcrito é igual ao DNA. Nos eucariotas o DNA tem intrões e asssim o RNA transcrito não corresponde exactamente ao DNA.

As bactérias e leveduras podem ser crescidas facilmente em grandes quantidades, o que permite a utilização destes organismos como "fábricas" de produção de proteínas. Se pretender utilizar estes organismos para produzir uma proteína humana, que aspectos terá de ter em consideração? Ao introduzir um gene que quero transcrito num procariota só posso por a parte codificante, sem intrões, ou seja tenho que introduzir um DNA que seja igual ao RNA eucariota que traduz essa proteina pois se introduzir o DNA directamente a transcrição não faria sentido. (o porquê está respondido na questão anterior)


*Sequenciação de DNA[edit] Introdução Estas sequências foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing



[edit] Questões Considere o seguinte resultado de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?


O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?


Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?



Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder?


Se a sequênciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações?


Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano?



Personal tools