User:Ana Luisa Van Innis/Notebook/Caderno BioMol/2010/04/27

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Entry title

Digestão de DNA com enzimas de restrição

As enzimas de restrição são o bisturi dos biologistas moleculares pois permitem “cortar” o DNA de um modo preciso e reprodutível.

As enzimas de restrição fazem parte do grupo das nucleases, enzimas que clivam ligações fosfodiester entre nucleótidos adjacentes. As enzimas de restrição usadas em biologia molecular têm a grande vantagem de clivarem apenas as ligações entre nucleótidos com uma sequência específica. Existem comercializadas perto de 100 enzimas de restrição, cada uma das quais reconhece e cliva uma sequência única de nucleótidos.

As enzimas de restrição identificam-se por uma nomenclatura própria. Por exemplo, EcoRI refere-se à primeira (I) enzima isolada do género Escherichia (E). espécie coli (co), estirpe RY13 (R) e Hind III à terceira enzima (III) isolada de Haemophilus influenzae, estirpe Rd.



Exercício 1 – Extremidades e ligações

Considere as seguintes enzimas e respectivas sequências de restrição ( o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT

  1. Que característica invulgar tem a sequência de reconhecimento destas enzimas?

A Característica invulgar desta sequência de reconhecimento é que as sequências dos ácidos nucleícos são palindrómicas, isto é a cadeia complementar (3'->5') é o espelho da primeira cadeia (5->3')

  2. Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas.


Bam HI:

---G GATCC---

---CCTAG G---


Hae II:

---GG CC---

---GG CC---

Eco RI:

---G AATCC---

---CCTAA G---

Bg1 II:

---A GATCT---

---TCTAG A---

  3. É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por:  BamHI? EcoRI? BglII?

Apenas é possível ligar extremidades de DNA cortadas com a mesma enzima de restrição e com a Bg1 II pois as extremidades são complementares. Com a EcoRI não é possível pois as extremidades não são complementares.

  4. Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique. 

A digestão através da enzima Bam HI vai originar segmentos maiores do que os fragmentos originados pela digestão da enzima Hae II. No genoma humano é mais provável encontrar sequenciais GG|CC (que são apenas 4 nucleótidos) do que sequências G|GATCC(com 6 nucleótidos). Assim, se houver mais locais de corte para a sequência GGCC, ou seja o local de corte da enzima Hae II, haverá um maior número de cortes e de menor tamanho do que a digestão com a enzima Bam HI.

  Exercício 2 – Mapas de restrição

As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose. Reveja os conceitos associados à electroforese em gel de agarose e veja um exemplo virtual da sua aplicação em http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html


  1. A que correspondem as bandas azuis no gel? 

As bandas azul-claro correspondem ao azul de xileno e as bandas azuis escuras correspondem ao azul de bromofenol. Estas bandas são necessárias para a orientação do processo de electroforese, de forma a poder localizar os fragmentos sem a utilização de luz UV.

  2. Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar?Porquê?

Com PleI espera-se 4 fragmentos e com BglI espera-se 3 fragmentos. Tanto com PleI e com o Bg1I observaM-se 3 fragmentos. isto é devido à concentraçao do gel, e nao consegue separar da melhor forma os fragmentos.

  3. Que papel tem a concentração de agarose na análise de fragmentos de restrição? 

O aumento da concentraçao de agarose vai diminuiro tamanho dos poros.O aumento do tamanho dos poros vai permitir aumentar resolucao da electroforese(ou seja permite distinguir melhor os fragmentos). o aumento do tamanho dos poros vai permitir assim aumentar a resolucao da electroforese

  4. Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo?

Para determinar o tamanho dos fragmentos de DNA de forma rigorosa usa-se um marcador molecular. Com este marcador é possível construir um recta de calibração (regressão linear), através da qual podemos definir o tamanho do fragmento a partir da distância que este percorreu no gel.


Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

  1.Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê?

A imagem apresenta um resultado de uma electroforese com 6 bandas. Ora, se o Eco RI corta o genoma do fago em 5 locais, originando 6 fragmentos, este resultado pode corresponder à digestão do fago pela enzima EcoRI.

  2. Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas: 
  2.1 Quantas moléculas de DNA estão na primeira e na última banda observadas no gel?

Considerando que 1 mol de base corresponde a 325g podemos saber o número de moléculas no gel , ou seja, o número de moléculas de DNA em cada banda. Desde modo sabe-se que existe 1,908x10^10 moléculas de DNA nas duas bandas. No primeiro fragmento temos 21228 moléculas de DNA, no segundo 4878, no terceiro 5643, no quarto 7421 e no ultiímo 3530 moléculas de DNA

  2.2 Que quantidade de DNA está nas mesmas bandas?

Na primeira banda existe 440ng de DNA e na segunda banda existe 73ng de DNA.


Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:


DNA x EcoRI = 5000 + 3000 + 2000 DNA x HindIII = 5500 + 4500 DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500 Com base nesta informação, construa o mapa de restrição

  1. Com base nesta informação, construa o mapa de restrição desta molécula.

Image:ALVI.JPG


Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:

Uma enzima de corte único: Accl. Uma enzima com dois cortes: Alel. uma enzima que não corta neste DNA:Aatl.

(ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)


[edit] Exercício 3 Enzimas de restrição, RFLPs (Restriction Fragment Length Polymorphisms) e diagnóstico de mutações As variações de sequência do genoma humano podem resultar na alterção de locais de corte de enzimas de restrição. As bandas polimórficas observadas após a electroforese de amostras de DNA genómico após tratamento com enzimas de restrição (RFLPs) constituíram o primeiro método laboratorial de “impressões digitais” de DNA para identificação de indivíduos em Medicina legal e forense.

Da mesma forma, mutações causadoras de doença podem gerar variações nos locais de corte de enzimas de restrição que permitem um fácil diagnóstico da sua presença.

O gene humano que codifica a beta-globina possui 3 locais de restrição DdeI. A distância entre o primeiro e o segundo local é de 175 bp. A distância entre o segundo e o terceiro local é de 201 bp. Em indivíduos com anemia de células falciformes ocorre uma mutação que anula o segundo local de restrição DdeI.

  1. Represente esquematicamente o gene normal e o gene mutado, indicando as posições relativas dos 3 locais DdeI.

gene normal -> 5' __________|_____175pb_______|_______201pb_______|_____________3'

gene mutado -> 5'__________|________________376pb________________|_____________3'

  2. Proponha um procedimento para diagnóstico desta mutação com base na técnica de PCR.

O PCR é uma técnica que permite a amplificação da região onde a mutação se localiza nos pacientes portadores da doença. Após a reacção de PCR, podemos utilizar o material amplificado para constatar a presença da mutação através da digestão com enzimas de restrição, hibridização com oligonucleotídeos ou sequenciamento. Neste caso apos a amplificaçao do fragmento utilizando primers que flaqueiam o local da mutação e faz-se a digestão com a enzima Ddel. Por fim, a visualização do resultado da digestão do DNA por esta enzima pode ser feito rercorrendo a técnica de electroforese. Caso haja mutação(individuo homozigótico) a enzima não reconhece o local de corte e por isso apenas se visualiza um fragmento; se não houver mutação(individuo homozigótico) a enzima corta e obtem-se 2 fragmentos. Existindo ainda a possibilidade de o individuo ser heterozigotico, obtêm-se 3 bandas, por existencia de um alelo mutado e de um alelo normal.

  3. Represente esquematicamente os resultados que espera observar ao analisar um indivíduo saudável, um portador da mutação (heterozigótico) e um doente (homozigótico).

Indivíduo saudável: 2 fragmentos (175 bp, 201bp).

Portador da mutação (Heterizigótico):3 fragmentos (175 bp, 201 bp, 376 bp).

Doente(Homozigótico): 1 fragmento (376 bp).

Retrieved from "http://openwetware.org/wiki/BIOMOL_LCS/2010:TP_6"

Personal tools