User:Ana Luisa Van Innis/Notebook/Caderno BioMol/2010/03/17

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Entry title

Sequenciação de DNA


Introdução As sequências de genes e mRNAs com que temos vindo a trabalhar foram obtidas experimentalmente com base na técnica de sequenciação de DNA desenvolvida nos anos 70 por Fred Sanger.

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing

Note que o resultado de uma sequenciação é um electroferograma, que depois é convertido em "As, Cs, Gs e Ts" por um programa informático.


Questões

 *O que é necessário para fazer uma reacção de sequenciação?

Para uma reacção de sequenciação é necessário: -Primer (complementar a sequência de DNA a sequenciar)

-dNTP's (A,T,G,C) e ddNTP's

-DNA polymerase

-molécula DNA a sequenciar

 *Que cadeia é sequenciada?

A cadeia sequenciada é que é usada como molde pelo primer, ou seja a sequência que se encontra na direcção 5' para 3'.

 *Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação?

Devido à utilização de ddNTPs (nucleotidos modificados que não possuem OH 3') que uma vez incorporados nas cadeias de DNA crescente não permitem a extensão desta pois não há formação da ligação fosfodiester.


 *Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo?

No método de Sanger tem de haver uma regulaçãp das quantidades de dNTP's em relação as quantidades de ddNTP's, em geral sendo maiores as quantidades de dNTP's. Isto é como há uma maior quantidade de dNTP's em relação a ddNTP's haverá sempre uma probabilidade maior que 0 de haver formação de fragmentos de tamanhos distintos, sendo este tamanho dependente da posição na cadeia em que é incorporado o ddNTP. Ou seja, a polimerização termina quando um ddNTP é colocado aleatoriamente na cadeia em vez do dNTP.

 *Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado.
 Que problemas consegue observar e porque sucedem?

Os problemas observados neste electroferograma são a sobreposição de picos(picos mal definidos)e diminuição da intensidade do sinal. A sobreposição dos picos é devido a falhas das técnicas de electroforese que vão diminuindo a resolução, sendo portanto dificil distinguir fragmentos de DNA com dimensões semelhantes. A diminuição da intensidade tem haver com o facto da DNA polimerase sintetizar com maior probabilidade fragmentos de menor dimensões do que fragmentos de grandes dimensões.


 * O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?

Utilizando a informação da primeira sequênciação, podemos repartir por várias sequênciações a região a cobrir, usando primers diferentes, avançando ao longo da sequência (Primer Walking Method). Também se pode usar o método de Shotgun Sequencing: Fragmentar o ADN em pedaços de tamanhos diferentes e com sobreposições múltiplas, que depois de lidos pelo método convencional, podem ser usados para reconstruir informáticamente a sequência inteira.


 *Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?

Individuo 1 - TCGTGTTCTATGATCATGAGAGTCGCCG Individuo 2 - TCGTGTTCTATGATGATGAGAGTCGCCG O segundo indíviduo é provavelmente heterozigótico na posição em que os dois diferem, C>G (no segundo o pico tem metade da intensidade e parece haver sobreposição de um pico azul e de um preto).


 *Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder?

Conhecendo o gene, utiliza-se um primer complementar e sequencia-se o gene. Com o mRNA é necessário isolar em primeiro a molécula, em seguida a transcrição reversa da molécula (utilizando a transcriptase reversa). Obtém-se assim o cDNA, e para iniciar a sequenciação usa-se um primer complemtar ao cDNA.

Personal tools