User:Ana Isabel F. Simoes/Notebook/Ana Simoes-biomol/2010/05/04

From OpenWetWare

Jump to: navigation, search

TP6 (continuação)

Digestão de DNA com enzimas de restrição

As enzimas de restrição são o bisturi dos biologistas moleculares pois permitem “cortar” o DNA de um modo preciso e reprodutível.

As enzimas de restrição fazem parte do grupo das nucleases, enzimas que clivam ligações fosfodiester entre nucleótidos adjacentes. As enzimas de restrição usadas em biologia molecular têm a grande vantagem de clivarem apenas as ligações entre nucleótidos com uma sequência específica. Existem comercializadas perto de 100 enzimas de restrição, cada uma das quais reconhece e cliva uma sequência única de nucleótidos.

As enzimas de restrição identificam-se por uma nomenclatura própria. Por exemplo, EcoRI refere-se à primeira (I) enzima isolada do género Escherichia (E). espécie coli (co), estirpe RY13 (R) e Hind III à terceira enzima (III) isolada de Haemophilus influenzae, estirpe Rd.

[edit] Exercício 1 – Extremidades e ligações Considere as seguintes enzimas e respectivas sequências de restrição ( o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT


Que característica invulgar tem a sequência de reconhecimento destas enzimas? Estas sequencias têm uma caracteristica específica, apresentam palindromia. Ou seja, quando se lêem ambas as cadeias no mesmo sentido (5'-3'), estas são iguais.


Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas.

            (3')                   (5')

Bam HI : -----G GATCC------------

       -----CCTAG                     G------------
     

Hae II: -----GG CC------------

       -----CC                       GG------------  

Eco RI: -----G AATTC------------

       -----CTTAA                     G------------

Bgl II: -----A GATCT------------

       -----TCTAG                     A------------

É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por: BamHI? EcoRI? BglII?

É possivel ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por bam HI uma vez que a sequência CTAG é complementar a GATC, sendo também possivel a ligação com extremidades cortadas por Bgl II, já que a sequência CTAG é complementar a GATCT.


Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique.

Os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores que os fragmentos resultantes de digestão com Hae II, uma vez que existe maior probabilidade de encontrar a seguencia GG|CC no genoma do que a G|GATCC, e como tal a Bam HI tem menor probabilidade de encontrar a sua sequência, originando fragmentos maiores.



[edit] Exercício 2 – Mapas de restrição

As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose. Reveja os conceitos associados à electroforese em gel de agarose e veja um exemplo virtual da sua aplicação em http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html



A que correspondem as bandas azuis no gel?

As bandas azuis no gel correspondem a fragmentos de DNA resultantes da acção das enzimas de restrição, migrando no gel de acordo com o seu tamanho (fragmentos maiores migram menos).


Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar? Porquê?

Com PleI espera-se 4 fragmentos e com BglI espera-se 3 fragmentos. Com PleI observa-se 3 fragmentos e com BglI obeserva-se 3 fragmentos. Como o gel se encontra concentrado não se consegue separar da melhor forma os fragmentos, pois dois deles estão sobrepostos.


Que papel tem a concentração de agarose na análise de fragmentos de restrição?

Consoante o tamanho dos fragmentos de restrição devemos variar a concentração de agarose. Assim, quanto mais pequenos forem os fragmentos mais concentrado deverá ser o gel, uma vez que estes por serem mais leves migram mais, correndo o risco de migrarem para fora do gel.


Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo?

A determinação rigorosa do tamanho dos fragmentos de DNA faz-se por medição da distância entre o ponto de aplicação do DNA no gel e o local onde se depositam os fragmentos. Uma vez que a distância percorrida é proporcional ao tamanho do fragmento, iremos construir uma curva de calibração, e através do valor da distância percorrida pelo fragmento iremos determinar o tamanho do fragmento.


Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê?

Sim, já que a enzima corta em 5 locais, como tal devem observar-se 6 fragmentos.


Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas: Quantas moléculas de DNA estão na primeira e na última banda observadas no gel?

DNA lambda = 31.6x10^5 Da 1 Da = 1.66x10^-27 g

DNA lambda = (31.6x10^5)*(1.66x10^-27) = 52,456 x 10^-22g

Logo,o número de moléculas de DNA na primeira e última banda é igual.


Que quantidade de DNA está nas mesmas bandas?

Para a primeira banda: 48510-1μg

                      21227-x                

x = 0.4376 μg

Para a última banda: 48510-1μg

                    3530-y

y = 0.0728 μg


Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:


DNA x EcoRI = 5000 + 3000 + 2000 DNA x HindIII = 5500 + 4500 DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500

Com base nesta informação, construa o mapa de restrição desta molécula.


|----------|-|---|------|

          E H   E     


O primeiro fragmento (5000) resulta do primeiro corte feito pela enzima EcoRI. O segundo fragmento (500) resulta do primeiro corte feito pela enzima EcoRI e do corte feito pela enzima HindIII. O terceiro fragmento (1500) resulta do corte realizado pela enzima HindIII e do segundo corte feito pela EcoRI. O ultimo fragmento (3000)resulta do segundo corte realizado pela EcoRI.


Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:

uma enzima de corte único - EcoRI (414/418) uma enzima com dois cortes - PleI (56/57, 188/189) uma enzima que não corta neste DNA - HaeII

(ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)



[edit] Exercício 3 – Enzimas de restrição, RFLPs (Restriction Fragment Length Polymorphisms) e diagnóstico de mutações As variações de sequência do genoma humano podem resultar na alterção de locais de corte de enzimas de restrição. As bandas polimórficas observadas após a electroforese de amostras de DNA genómico após tratamento com enzimas de restrição (RFLPs) constituíram o primeiro método laboratorial de “impressões digitais” de DNA para identificação de indivíduos em Medicina legal e forense.

Da mesma forma, mutações causadoras de doença podem gerar variações nos locais de corte de enzimas de restrição que permitem um fácil diagnóstico da sua presença.

O gene humano que codifica a beta-globina possui 3 locais de restrição DdeI. A distância entre o primeiro e o segundo local é de 175 bp. A distância entre o segundo e o terceiro local é de 201 bp. Em indivíduos com anemia de células falciformes ocorre uma mutação que anula o segundo local de restrição DdeI.


Represente esquematicamente o gene normal e o gene mutado, indicando as posições relativas dos 3 locais DdeI.

gene normal: |----|-| gene mutado: |-----|


Proponha um procedimento para diagnóstico desta mutação com base na técnica de PCR.

Para diagnosticar a mutação iria proceder a um PCR com a enzima DdeI, que em casos normais cortaria no local da mutação. Após uma electroforese, com base no número de fragmentos obtidos, determinaria sehavia mutação ou não.


Represente esquematicamente os resultados que espera observar ao analisar um indivíduo saudável, um portador da mutação (heterozigótico) e um doente (homozigótico).

Indivíduo saudável: 2 fragmentos (175 bp, 201bp) Portador de mutação: 1 fragmento (376 bp) - homorozigótico

                    3 fragmentos (175 bp, 201 bp, 376 bp) - heterozigótico




Personal tools