User:Ana Isabel F. Simoes/Notebook/Ana Simoes-biomol/2010/04/20

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

TP5

Questões

Que características deve ter um primer de PCR?

Um primer corresponde a um fragemnto de DNA de 15-30 nucleotidos com um conteudo elevado em GC(40-60%). Numa reacção de PCR existem dois primers(Forward e Reverse) ligados à terminação 3' complementar a cada uma das cadeia simples de DNA. A ligação dos primers À cadeia ocorre a temperaturas entre 50 e 65ºC.


Como qualquer DNA polimerase, a transcriptase reversa requer um primer iniciador, que pode ser de 3 tipos distintos: específico de gene, oligo-dT ou random (uma mistura aleatória de 6 a 8 nucleótidos). Em que situações pode ser utilizado cada um destes primers e que vantagens/desvantagens relativas apresentam?

O primer específico de gene deve ser utilizado quando pretendemos obter fragmentos de DNA específicos do gene que está a ser estudado. Por exemplo, no caso de uma mutação génica este método facilmente nos permite identificar essa alteração nos genes. Este método contudo não é muito adequado quando pretendemos sequenciar diferentes fragmentos de DNA. O primer oligo-dT é util quando se pretende transcrever fragmentos de mRNA com cauda de poli-A, não sendo adequado quando se quer obter fragmentos de DNA de outras regiões sem esta terminação. O primer Random tem a vantagem de poder ser utilizado para transcrever diferentes regiões e tipos de RNA uma vez que são utilizados diferentes primers permitindo-nos sequenciar a região terminal da cadeia que pela utilização de um unico primer seria difici. Possui como desvantagem o facto de não ser específico para quando queremos transcrever sequências específicas e de transcrever demasiados fragmentos de RNA.


Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo.

Procedimento experimental

1. Recolha da amostra - esfregaço de células da mucosa, sangue...

2. Construção de primers com o auxílio do programa 'primer3'

LEFT primer: CATATTCTGGAGACGCAGGA

RIGHT primer: TGCTCAAGGCCCTTCATAAT

Estes primers podem ser usados uma vez que cobrem a área de interesse(onde está presente a mutação).

3. Lise dos eritrócitos para obtenção do DNA

4. Preparação da mix para o PCR:

DNAtemplate, primers F e R, Taq pol, dNTPs, solução tampão e H20.

5. PCR

6. Electroforese com produto de PCR para verificar se a reacção de PCR correu conforme o esperado.

7. Purificação do DNA sequenciado para remover as sequências de primers.

8. Desenhar primers para a região mutada:

a.	CATATTCTGGAGACGCAGGA (5’ → 3’)
b.	TGTACACATATTGACCAAATCAGG (5’ → 3’)
c.	ATGGGACGCTTGATGTTTTC (5’ → 3’)
d.	GGCATAAAAGTCAGGGCAGA (5’ → 3’)

9. Mix para sequenciação:

DNA template, primers, DNA pol, dNTPs e ddNTPs.

10. Comparar os resultados obtidos com a sequência de uma base de dados(BLAST)

Este procedimento deve ser aplicado tanto aos pais como à própria Maria para que sejam identificadas (após comparação)as mutações.


Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.

Para estudar a expressão do gene partindo do mRNA de cada individuo, é possivel obter cDNA pela acção da transcriptase reversa (RT-PCR).O cDNA é analisado posteriormente quanto ao tamanho e composição da sequência sendo então por fim comparada com sequências sem mutação

1. recolha da amostra biológica

2. lise dos eritrócitos para obtenção do RNA

3. Construção dos primers para RT PCR

4. mix para RT PCR:

RNA, MgCl2, dNTPs, transcriptase reversa, solução tampáo, Água e primers. (de seguida trata-se de uma reacção semelhante à anterior)

5. design de primers

LEFT primer: TCTGTCCACTCCTGATGCTG

RIGHT primer: CTTTCTTGCCATGAGCCTTC

6.Realização de PCR (água, cDNA, TAQpol, primers, solução tampão, dNTPs)

7. electroforese

8. análise da sequenciação e comparação com a sequência dos pais e a sequência do BLAST

9. apresentação de resultados



Personal tools