User:Ana Isabel F. Simoes/Notebook/Ana Simoes-biomol/2010/03/16

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

TP3

Sequenciação de DNA

Introdução


As sequências de genes e mRNAs com que temos vindo a trabalhar foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing

Note que o resultado de uma sequenciação é um electroferograma, que depois é convertido em "As, Cs, Gs e Ts" por um programa informático.



Questões

O que é necessário para fazer uma reacção de sequenciação?

São necessários Primers, polDNA, os 4 dNTPs(A;T;C;G) e a cadeia de DNA codificante a replicar


Que cadeia é sequenciada?

Através da sequenciação conseguimos obter uma nova cadeia que vai ser igual à cadeia complementar (da cadeia molde).


Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação?

Esta sequenciação é considerada por terminação devido à adição de didesoxirribonucleótidos que vão bloquear o crescimento do DNA em replicação.


Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo?

A sequênciação não termina no primeiro nuclótido de cada tipo porque em cada fragmento o primeiro nucleótido pode não ser um didNTP e assim o crescimento da cadeia não é impedido.



Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?

Existem alguns problemas aparentes. Em primeiro lugar é perceptivel uns picos de intensidade de fluorescência reduzida. Esta intensidade é reduzida quando temos fragmentos de grandes dimensões e a polimerase tem dificuldade em ligar-se a apenas um nucleótido (são formadas moléculas mais pequenas). Para além disto, temos picos mais largos devido a falhas na electroforese(diminuição da resolução) em que se torna dificil distinguir fragmentos de DNA de dimensão semelhante(começa a haver sobreposição dos mesmos).


O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?

Para analisarmos o fragmento completo poderíamos inicialmente sequenciar a primeira porção do nosso DNA e seguidamente proceder à elaboração de um primer correspondente à região terminal dessa sequência para desta forma por 'pedaços' conseguirmos obter a sequência completa.


Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo? Preto (G), Vermelho (T), azul (C), verde (A)

Individuo 1: TCGTGTTCTATGATCATGAGAGTCGCCG Indivíduo 2: TCGTGTTCTATGATGATGAGAGTCGCCG


Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder? Considere os resultados da sequenciação discutida no Caso de Estudo 1.


Que aspecto esperaria encontrar no electroferograma na região variável de cada indivíduo? Se tivesse apenas acesso aos resultados da sequenciação da Maria, seria capaz de definir o seu genótipo com rigor? Justifique. Com base na sequência do gene da beta-globina disponível na última TP e as técnicas de análise de sequências que tem vindo a aprender identifique as regiões do gene em que se localizam as alterações pontuais encontradas.


[edit] Para pensar Se a sequenciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações?


Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano? Retrieved from "http://www.openwetware.org/wiki/BIOMOL_LCS/2010:TP_3"





|}


Personal tools