User:Ana Claudia De O. Manata/Notebook/Aulas TP Bio Molecular/2010/03/23

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

PCR e RT-PCR

Introdução

A técnica do PCR permite obter um grande número de cópias de uma sequência de DNA de interesse a partir de uma quantidade mínima de material. Nas aplicações de maior sensibilidade, uma única molécula de DNA pode ser suficiente para gerar milhões de cópias. Este é por issoo método base para um número muito grande de técnicas de diagnóstico molecular, incluindo em particular os diagnósticos que requerem sequenciação de DNA.

A seguinte animação explica o funcionamento da técnica: PCR

Quando é necessário proceder à caracterização da expressão de genes, é também possível aplicar a técnica de PCR acoplando-a a uma reacção de transcrição reversa, como explicado na seguinte animação: RT-PCR

Note que o resultado de um ensaio de PCR ou RT-PCR tem geralmente de ser visualisado por separação electroforética dos produtos de reacção.


Questões

  • Que características deve ter um primer de PCR?

Comprimento do primer (18 a 22 pb); Temperatura de desnaturação entre 52-58ºC; Conteúdo em GC (40-60%) - Influencia a temperatura de desnaturação; Presença de G ou C nas últimas 5 bases do terminal 3' - Estabilidade do terminal; Não ter estruturas secundárias (e.g. hairpins); Evitar repetições de nucleótidos; Evitar homologia cruzada.


  • Como qualquer DNA polimerase, a transcriptase reversa requer um primer iniciador, que pode ser de 3 tipos distintos: específico de gene, oligo-dT ou random (uma mistura aleatória de 6 a 8 nucleótidos). Em que situações pode ser utilizado cada um destes primers e que vantagens/desvantagens relativas apresentam?

Específico de gene: sequência complementar a um determinado gene de interesse; Vantagem: produção de cDNA correspondente apenas ao gene que se quer estudar, poupando análise de informação desnecessária; Desvantagem: no estudo de vários genes em simultâneo não é possível pois só são obtidos os resultados do gene para o qual o primer é específico.

Oligo-dT: desoxinucleótido de timina que hibrida mRNA num terminal 3' poli-A; Vantagens: com uma única reacção de RT-PCR todos os mRNA são convertidos em cDNA; Desvantagens: como os oligo-dT estão ligados ao terminal, sequências demasiado longas podem não ser convertidas e, além disto, todos os RNA que não tenham a cauda poli-A não são obtidas em cDNA.

Random: usado para gerar cDNA a partir de uma amostra de RNA; Vantagem: melhor obtenção e distribuição das regiões codificantes e não-codificantes; Desvantagem: produção de cDNA de todos os RNA, e não apenas de mRNA, e com dimensões variáveis, imprevisíveis e que podem ser incompletas e insuficientes.


  • Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo.

Recorrendo a um protocolo que inclui a técnica de PCR e posterior sequenciação, e submetendo as amostras de cada um dos indivíduos da família ao procedimento experimental, é possível a identificação das mutações.

Procedimento experimental:

1. Design do par de primers que permitam a síntese da região do gene que é transcrita por PCR:

  a.	LEFT primer: CATATTCTGGAGACGCAGGA
  b.	RIGHT primer: TGCTCAAGGCCCTTCATAAT

2. Recolha da amostra biológica - esfregaço de células da mucosa bucal

3. Hidrólise ácida das células para obtenção do DNA

4. Preparar mix para PCR:

  a.	Amostra de DNA
  b.	2 primers
  c.	Taq polimerase
  d.	dNTPs
  e.	Solução tampão
  f.	Água

5. Realizar PCR e fazer uma electroforese

6. Purificação do DNA, obtido no PCR, para eliminar as sequências correspondentes aos primers

7. Design dos primers que permitam a sequenciação da região do gene que contém as mutações:

  a.	CATATTCTGGAGACGCAGGA (5’ → 3’)
  b.	TGTACACATATTGACCAAATCAGG (5’ → 3’)
  c.	ATGGGACGCTTGATGTTTTC (5’ → 3’)
  d.	GGCATAAAAGTCAGGGCAGA (5’ → 3’)

8. Preparar mix para sequenciação:

  a.	DNA template
  b.	Primers
  c.	DNA polimerase
  d.	dNTP (A, T, C e G)
  e.	ddNTP

9. Análise dos resultados – comparar os resultados da sequenciação com a sequência de referência (BLAST)


  • Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.

Para estudar a expressão do gene poderá recorrer-se à técnica de RT-PCR. Pela acção da enzima transcriptase reversa, a partir do mRNA, presente em cada indivíduo, obtém-se cDNA, que é estudado quantitativa e qualitativamente, comparando sequências obtidas com as sequências sem mutação.

Procedimento experimental:

1. Design dos primers para a reacção de RT:

  b.	RIGHT primer: CTTTCTTGCCATGAGCCTTC

2. Recolha da amostra biológica - sangue

3. Lise dos eritrócitos para obtenção do RNA (e sua preparação)

4. Preparar mix para reacção de RT:

  a.	RNA desnaturado
  b.	Solução tampão
  c.	dNTPs
  d.	MgCl2
  e.	Primers
  f.	Transcriptase reversa
  g.	Água

5. Design dos primers para a reacção de PCR:

  a.	LEFT primer: TCTGTCCACTCCTGATGCTG
  b.	RIGHT primer: CTTTCTTGCCATGAGCCTTC

6. Preparar mix para PCR:

  a.	cDNA
  b.	Solução tampão
  c.	Taq polimerase
  d.	2 primers
  e.	dNTPs
  f.	Água

7. Realizar PCR e fazer uma electroforese

8. Análise dos resultados

Nota:

Se quiser incluir detalhes práticos sobre as reacções, consulte: Protocolo Taq polimerase Protocolo Transcriptase reversa



Personal tools