User:Amanda Zimmerman/Notebook/Biology 210 at AU

From OpenWetWare

Jump to: navigation, search

Name: Amanda Zimmerman, Group 5, The Prairie

March 21st, 2014 Date observed: March 6th, 2014

Purpose: To finalize the analysis of the difference in size, motility, and behavior between the embryos and development of Zebrafish in the control plate and the caffeine water plate

Hypothesis/Prediction: The observations seen on Day 4 and Day 7 will continue to be seen even more drastically

Procedure:

  • Both Zebrafish plates were obtained and analyzed under a microscope for final investigations
  • Any waste/egg shells/dead fish were removed with a transfer pipet
  • The fish fixed in the paraformaldehyde were poured onto a depression slide then analyzed under the microscope

Observations:

  • The water level in both plates were critically and fatally low
  • All fish in both plates were dead
  • The fish were never fed the paramecium as they were supposed to be
  • Data and photos of the fixed Zebrafish can be found at the following link: /Users/Amanda/Pictures/iPhoto Library.photolibrary/Previews/2014/03/16/20140316-211149/uK0lU+q3TvWIXZMEgqG2Pg/IMG_4630.jpg

Conclusion: The actual observations under the microscope are quite peculiar, given the literature. The eyes on the caffeine fish are bigger than those of the control fish. The heads are overall about the same. The tails of the caffeine fish vary more than those of the control, yet it appeared earlier in the experiment that the caffeine fishes' sizes varied less. However, it was not surprisingly that the one caffeine fish had a curvature in the spine, due to the retardation in growth. I'm unsure why the heads of some fish are darker than the others. In the end, most of our data refutes that of the pertinent literature listed earlier.

Date observed: February 27th, 2014 (Day 7)

Purpose: To further analyze any difference in size, motility, and behavior between the embryos and development of Zebrafish in the control plate and the caffeine water plate.

Hypothesis/Prediction: The observations from Day 4 will continue to hold true, but with further, more obvious, motor defects. I don't expect a change in size.

Procedure:

  • Both Zebrafish plates were obtained and analyzed under a microscope
  • Any waste/egg shells/dead fish were removed with a transfer pipet
  • The number of hatched fish and embryos present were counted
  • Differences from Day 4 regarding size, motility, appearance, behavior, etc. were taken
  • 2 Zebrafish from each plate were fixed in their own tube (one tube for the control, the other tube for the caffeine) in paraformaldehyde for one week

Observations:

    • Control group:
  • Fish present: 14
  • Fish dead: 0
  • Loss of fish: 4 from this week, 2 from the week before
  • Overall observations: Movement seems to be a little slower (more lethargic) than the week before, eye and tail movement still seem healthy and normal, no unnecessarily agitated or frantic movement present
  • How many taken for fixing: 2
    • Caffeine group:
  • Fish present: 18
  • Fish dead: 0
  • Loss of fish: 2 from this week, 0 from the week before
  • Overall observations: The one unhatched embryo had hatched, the tails and heads are visibly smaller than those of the control group, all are thinner than those of the control group, more sporadic and rapid movement
  • How many were taken for fixing: 2

Conclusions: It is unknown where the missing fish went- there was no dead fish matter present in the plate. The caffeine group continued to follow the trend of Day 4, which matched the trend in the pertinent literature.

Date observed: February 24th, 2014 (Day 4)

Purpose: To analyze any difference in size, motility, and behavior between the embryos and development of Zebrafish in the control plate and the caffeine water plate.

Hypothesis/Prediction: The Zebrafish grown in caffeine water environment will have motility defects or abnormalities as well as be smaller in appearance. It is also expected that there will be more deaths in the caffeine water plate than in the deer park water plate.

Procedure:

  • Both Zebrafish plates were obtained and analyzed under a microscope
  • All shell matter was removed with a transfer pipet
  • The number of hatched fish and embryos present were counted
  • Observations regarding size, motility, appearance, behavior, etc. were taken
  • 5.0 mL of deer park water and the caffeine water were added to the control and caffeine plates respectively

Observations:

Conclusions: The Zebrafish in the caffeine plate are overall smaller, but vary less in size and movement. The Zebrafish in the caffeine plate are overall more hectic and frantic in terms of motion and response. Additionally, their eyes are smaller and move less. Therefore, the literature is confirmed in the sense that the fish are smaller and have motor defects.

Date observed: February 20th, 2014

Purpose:To set up the two different conditions, a positive control, 25 mg/L of caffeine water, plate and a negative control, deer park water, plate in for the fish embryos to grow in. The difference in growth size and movement will be analyzed.

Hypothesis/Prediction: Growing Zebrafish embryos in 25 mg/L of caffeine water will cause the fish to have birth defects, have a stunt in their growth, and have impulsive, erratic motions due to the negative effects of caffeine on the body. However, in this particular part of the experiment, setting up the plates, we will see no difference.

Pertinent Literature: The article "Movement Disorder and Neuromuscular Change in Zebrafish Embryos After Exposure to Caffeine" (Chen et al, 2008) tested the toxicity and teratogenicity of caffeine on Zebrafish embryos by performing time and dose dependent caffeine exposure experiments. They expected that fetal growth retardation would occur as well as motor neuron defects when treated with a significant amount of caffeine. Their results found that when create with less that 150 ppm of caffeine, approximately 149 mg/L, caused no significant difference in survival rate. As exposure rate increased, survival rate decreased. However, over 300 ppm, approximately 299.65 mg/L, caused all embryos to die. With that, there was a misalignment of muscle fibers and motor neuron defects.

Procedure:

  • 20 mLs of fresh deer park water were put into a plate
  • 20 live Zebrafish embryos were then placed into the plate with a transfer pipet
  • The age, in hours, of each embryo was examined under a microscope
  • The previous three steps were repeated in a separate plate, but with 25 mg/L of caffeine water, as opposed to deer park water.
  • Both of the plates were covered with a lid then left on a tray in the lab to rest.

Calculations:

  • 25 mg/L of caffeine water
  • Used 20 mLs of caffeine water
  • Total caffeine in substance= (mLs of caffeine water used)(1 L/1000 mL)(g of caffeine water/L)
  • Total caffeine in substance= (20 mLs of caffeine water)(1 L/1000 mL)(25 mg of caffeine water/L)= 0.5 mg of caffeine

Observations:

    • Caffeine water plate:
  • 12 hours old: 9 embryos
  • 14 hours old: 6 embryos
  • 16 hours old: 2 embryos
  • 18 hours old: 3 embryos
  • No abnormalities seen in color, shape, or movement. No other external stimuli present
    • Control, deer park water, plate
  • 12 hours old: 8 embryos
  • 14 hours old: 3 embryos
  • 16 hours old: 5 embryos
  • 18 hours old: 4 embryos
  • No abnormalities seen in color, shape, or movement. No other external stimuli present

Conclusions: No conclusions of differences can be drawn at this point. However, the conditions have been set for the experiment to occur undisturbed.

March 2nd, 2014 Date observed: March 2nd, 2014

Procedures:

  • -Procedure 1: Identifying Bacteria through DNA Sequencing
  • Sequences of the bacterial DNA were sent to a lab and recorded
  • The DNA sequences were put in the NCBI Blast database to locate the Genus species name of each bacteria
  • The names and descriptions were compared with literature online

Observations:

  • -Observations for Bacteria #1:
  • DNA sequence for bacteria on 10^-3 nutrient agar plate
  • Our data said that this bacteria was a yellow and orange combination of circular gram positive streptobacilli bacteria colonies.
  • The data sequence was as follows: GCTACTCTCACGAGAGTAGGTTTATCCCTATACAAAAGAAGTTTACAACCCATAGGGCCGTCGTCCTTCACGCGGGATGGCTGGATCAGGCTCTCACCCATTGTCCAATATTCCTCACTGCTGCCTCCCGTAGGAGTCTGGTCCGTGTCTCAGTACCAGTGTGGGGGATCACCCTCTCAGGCCCCCTAAAGATCGCAGACTTGGTGAGCCGTTACCTCACCAACTATCTAATCTTGCGCGTGCCCATCTCTATCCACCGGAGTTTTCAATACCGAATGATGCCATCCAGTATATTATGGGGTATTAATCTTCCTTTCGAAAGGCTATCCCCCAGATAAAGGCAGGTTGCACACGTGTTCCGCACCCGTACGCCGCTCTCAAGATTCCGAAGAATCTCTACCGCTCGG
  • According to NCBI Blast, this bacteria is Chryseobacterium indologenes
  • According to the literature found at http://microbewiki.kenyon.edu/index.php/Chryseobacterium_indologenes, this bacteria is actually gram negative, but has a physical appearance exactly of what was seen on our plate. Additionally, it is rod-shaped, as we had examined, with a round, circular colony shape. This bacteria is commonly found in soil, contaminated food, contaminated water sources, and hospitals.
  • -Observations for Bacteria #2:
  • DNA sequence for bacteria on 10^-5 nutrient agar plate
  • Our data classified this bacteria as a white-grey (to the naked eye), gram negative bacteria in the streptococcus formation
  • The data sequence was as follows: AAGTCGAACGGTAGCACAGAGAGCTTGCTCTCGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGTGTTG
  • According to NCBI Blast, this bacteria is Enterobacter cloacae
  • According to the literature found at http://nanologix.com/bacteria/enterobacter_cloacae.html, this bacteria is gram negative, but actually rod-shaped and flagellated (we were unable to determine the presence of flagella). Thus, it is not a streptococcus formation, unlike our determination. This bacteria is a facultative anaerobe, thus it is able to use oxygen for respiration or use other electron carriers. It is often found in hospitals when patients have an extensive stay time.
  • -Observations for Bacteria #3:
  • DNA sequence for bacteria on 10^-3 plus tet agar plate
  • Our data said that this bacteria was colorless with a white powder-like substance growing on the plate. It appeared to be filamentous and arranged in streptobacilli colonies. It also appeared to be gram positive.
  • The data sequence was as follows: GTACCTTCNGCTACCCTCACGAGGGTAGGTTTATCCCTATACAAAAGAAGTTTACAACCCATAGGGCCGTCGTCCTTCACGCGGGATGGCTGGATCAGGCTCTCACCCATTGTCCAATATTCCTCACTGCTGCCTCCCGTAGGAGTCTGGTCCGTGTCTCAGTACCAGTGTGGGGGATCACCCTCTCAGGCCCCCTAAAGATCGTTGACTTGGTGAGCCGTTACCTCACCAACTATCTAATCTTGCGCGTGCCCATCTCTATCCACCGGAGTTTTCAATTTAAAATGATGCCATTCTAAATATTATGGGGTATTAATCTCCCTTTCGAAAGGCTATCC
  • According to NCBI Blast, this bacteria is Chryseobacterium with an unknown species
  • The observations of Bacteria #1 from http://microbewiki.kenyon.edu/index.php/Chryseobacterium_indologenes may also be applied to this bacteria.

Conclusions: None of our bacterial observations held 100% true to the data of NCBI Blast. We had predicted that bacteria #1 and 3 were gram positive, when they were gram negative. However, the majority of the other observations hold true, thus I believe that bacteria #1 and 3 were from the Chryseobacterium genus. On the other hand, bacteria #2 was determined to be gram negative, as observed, but had a completely different shape. Additionally, it was noted to be found in hospitals, while we found ours in soil. Unless there are other sources that prove that it is seen in soil, then there may have been an error.

February 22nd, 2014 Date observed: February 20th, 2014

Goals/objectives: To understand the importance of invertebrates and to learn how simple systems (including specialized cells and overall body plan) evolved into more complex systems

Procedures:

  • -Procedure 1: Observing Acoleomates, Pseudocoelomates, and Coelomates
  • 1) An acoelomate, planaria, was observed under a microscope. Its appearance and movements were noted. Its cross-section diagram was observed on a piece of paper
  • 2) A pseudocoelomate, nematode, was observed under a microscope. Its movement and body structure were noted. Its cross-section diagram was observed on a piece of paper
  • 3) An Annelida coelomate, earth worm, was observed in a container. Its route of motion and appearance were noted.
  • -Procedure 2: Analyzing the Invertebrates Collected in the Burlese Funnel
  • The Burlese funnel was broken down by the TA, separating the top half of the collection from the bottom half in order to show the difference in density between the species
  • The liquid collections were each poured into their own petri dish and each examined under a microscope for observations
  • Each dish determined which invertebrates were found
  • The observations were recorded in a table
  • -Procedure 3: Vertebrates and Niches
  • 1) The vertebrates that may pass through are transect were considered and noted

Observations:

  • -Observations of Acoelomates, Pseudocoelomates, and Coelomates
  • The acoleomate planaria was shaped like a rhombus. The body structure was not complex or segmented, but simple and symmetrical. It swam as if it was following a path in a wide, circular motion. It moved gracefully.
  • The nematode was in between the planaria and earth worm in the sense that is was unsegmented and smooth-bodied like the planaria, but shaped like the earth worm. Its movement pattern was closer to the earth worm's than the planaria's
  • The coelomate earth worm was pink-grey and tube-like. However, it had a segmented body and moved in whichever direction it pleased. It folded over itself several times, showing the complexity and sophistication of its internal structure to be able to do this. It moved by expanding and contracting itself.
  • -Observations of Analyzing the Invertebrates Collected in the Burlese Funnel
  • The spider collected in the leaf litter was not caught in the Burlese funnel; it must have escaped within the incubation period
  • Only insects were found in our Burlese funnel
  • There were a total of 13 insects found
  • According to the Dichotomous key, all of our insects were primitive insects
  • The size range was from 1-4 mm, they were all quite small
  • I was initially surprised that we found no earth worms, however we did take the leaf litter from the topmost part of the soil, while earthworms may be at the bottom seeking nutrients
  • The table describing each invertebrate found along with a picture of them can be seen at https://docs.google.com/a/student.american.edu/document/d/1quTFWToA71lC_RlmLiccTdm7yJ8O5EzQB9b0BxkpUfI/edit
  • -Observations of Vertebrates and Niches
  • Five species of vertebrates that may pass through are transect include the following: Humans, birds (perhaps a robin and a sparrow) , squirrels, and cats
  • The classification of each is as follows:
  • The tree close by in the transect may provide nuts, food, for squirrels to eat. Likewise, robins and sparrows could use the soil to find food, as there are invertebrates in the soil that match the needs of the two birds. Cats can use the transect as a habitat, as the bushes, especially when they have leaves on them, can provide as a hiding spot from predators. In fact, all of the formerly mentioned species could use the transect as a hiding place from predators. Finally, humans use the transect for aesthetic pleasure and for creation. For example, humans put together the abiotic factors of the transect in an aesthetically pleasing way in order to create something new.
  • A food web of our transect could possibly be as follows
  • Primary producer: Dead leaves and grass from our different plants
  • Primary decomposer: Bacteria, archaea, and invertebrates
  • Secondary consumer: Earth worms
  • Tertiary consumer: Robins and sparrows
  • Quaternary consumer: Squirrels, cats, and humans

Conclusions: There is a noticeable difference between acoelomates, pseudocoelomates, and coelomates. Their body structures and movement patterns differ, as they have different levels of specialization and complexity. Although arthropods were the only invertebrates found in our Burlese funnel, I also believe there were others, such as arachnids (since we did initially have a spider) and earthworms in the lower levels. Additionally, some new invertebrates and vertebrates may arise in the transect as the weather continues to improve.

Photos: The one photo from this section can be found at https://docs.google.com/a/student.american.edu/document/d/1quTFWToA71lC_RlmLiccTdm7yJ8O5EzQB9b0BxkpUfI/edit


February 10th, 2014 Date observed: February 6th, 2014

Goals/objectives: To understand the characteristics and diversity of Plants and to appreciate the function and importance of Fungi

Procedures:

  • -Procedure 1: Collecting five plant samples from the transect
  • 1) Three bags were brought to the transect
  • 2) The first bag was filled halfway with leaf litter, which was an area of soft soil and dead leaves. Only the top, crumply layer was dug through and collected.
  • 3) Representative samples from each of the 5 plants was taken, making sure that minimal damage occurred.
  • 4) Pictures of the plants were taken
  • 5) Any seeds, pine cones, flowers, etc. were obtained from the plants and brought back
  • 6) The plants were described in our notebooks
  • -Procedure 2: Plant Vascularization
  • 1) The moss was observed and its height was noted
  • 2) The cross section slide of the lily stem was observed, identifying the xylem, phloem, and height of the lily plant stem
  • 3) The vascularization of each plant was noted
  • -Procedure 3: Plant Specialization
  • 1) The leaves of moss were examined and noted
  • 2) The cross-section of an angiosperm leaf was examined and noted
  • 3) The shape, size, and cluster arrangement of the leaves from the transect were noted and described
  • -Procedure 4: Plant Reproduction
  • 1) The diagram of the bryophyte reproductive cycle was studied
  • 2) The male and female gametophytes as well as the sporophytes were identified
  • 3) A lily flower was dissected in order to find the anther, ovary, stigma, and filament
  • 4) The soaking seeds were examined and classifying
  • 5) Our seeds from the transect were classified as either monocots or dicots, while evidence of flowers and spores were noted
  • -Procedure 5: Observing Fungi
  • 1) The black bread mold was observed under a dissecting scope
  • 2) The whitish mass was noted
  • 3) The small, rootlike hyphae were found and noted
  • 4) The given samples were examined under a microscope then described and identified
  • -Procedure 6: Setting up the Burlese Funnel to Collect Invertebrates
  • 1) 25 mL of 50:50 ethanol/water solution was poured into a flask
  • 2) A piece of the screening material was placed in the bottom of the funnel with the sides taped down
  • 3) The funnel was placed into the neck of the flask
  • 4) The leaf litter sample was placed carefully in the top of the funnel
  • 5) The contraption was placed under an incandescent lightbulb for one week then covered with foil

Observations:

Conclusions: The five plants are all unique, as they all have a special combination of vascularization, specialization, and reproduction. At the moment, due to our harsh weather conditions, it is difficult to tell the specificities in terms of these three since the weather has left them dead. Additionally, fungi, although they may be found with plants, are their own specialized group. They have intricate divisions, reproductive ways, ways of getting water and nutrients, etc. Next week we will be looking at Kingdom Animalia by observing invertebrates found in our leaf litter.

Photos: See https://docs.google.com/a/student.american.edu/document/d/1quTFWToA71lC_RlmLiccTdm7yJ8O5EzQB9b0BxkpUfI/edit

February 3rd, 2014 Date observed: January 30th, 2014

Goals/objectives: To understand the characteristics of bacteria, to observe antibiotic resistance, and to understand how DNA sequences are used to identify species

Procedures:

  • -Procedure 1: Quantifying and Observing Microorganisms
  • 1) The Hay infusion culture was obtained and noted in terms of differences in smell or appearance.
  • 2) A handout was obtained regarding how to characterize colony morphology
  • 3) The total number of colonies on each plate were counted and recorded
  • -Procedure 2: Antibiotic Resistance
  • 1) Observe the colonies that grew on the tetracycline plates
  • -Procedure 3: Bacteria Cell Morphology Observations
  • 1) A prepared slide containing different types and shapes of bacteria were obtained and observed in order to get a base idea of the difference morphologies with both the 4x, 10x, and 40x
  • 2) A small drop of oil was placed on the slide, then the 100x oil immersion lens was used to observe the slide
  • 3) Two samples from the nutrient agar plate and one from the nutrient agar plus get plate were isolated to be used in a wet mount and gram stain
  • 4) Each sample was scraped onto a slide with a drop of water then sterilized over an open flame then covered with a cover slip and observed under the microscope with a 10x and 40x objective lens and the cell shapes and motility noted
  • 5) A Gram stain was prepared for each sample as follows:
  • Each slide was labeled
  • The slide was heat-fixed over a bunsen burner with the bacterial side up
  • Crystal violet dye was used to cover the stain for 1 minute
  • The crystal violet stain was rinsed off with water
  • Gram's iodine mordant was used to cover the stain for 1 minute then rinsed off gently
  • 95% alcohol was used to decolorize the slides for 10-20 seconds
  • The slides were rinsed gently until the slides were completely decolorized
  • Safranin stain was used to cover the stain for 20-30 seconds
  • The slides were rinsed gently
  • Excess water was blotted carefully with a wet paper towel
  • 6) The slides were observed under a 4x, then 10x, then 40x, and finally the 100x oil immersion lens without a cover slip
  • -Procedure 4: Start PCR Preparation for DNA Sequencing Identification
  • 1) DNA was isolated from the bacterial colonies on the same plates as used earlier in the experiment
  • 2) Each colony was transferred into separate 100 microliters of water in a sterile tube
  • 3) Each tube was incubated at 100 degrees Celsius for 10 minutes
  • 4) Each tube was centrifuged for 1 minute
  • 5) 5 micro liters of the supernatant for each tube was placed in its own tube consisting of 27F and 519R primer sequences to locate the 16S rRNA gene presence
  • 6) The tubes were saved for a PCR reaction to be done in one week

Observations:

  • -Observations of quantifying and observing microorganisms:
  • I don't think that archaea would have grown on the nutrient agar plates or the nutrient agar plus tet plates because the living conditions of archaea do not match those of the agar plates' environments
  • The smell and change of the Hay infusion may have changed due to the lack of sunlight and over abundance of water, causing deterioration of the grass, flower, species growing off of the flower, and film on top. The deterioration may have released chemicals as it reacted, inducing an odor
  • Table 1: 100-fold Serial dilutions results:
  • - See https://docs.google.com/a/student.american.edu/document/d/1quTFWToA71lC_RlmLiccTdm7yJ8O5EzQB9b0BxkpUfI/edit
  • -Observations of antibiotic resistance:
  • There are obvious, apparent differences in the plates with and without tetracycline, the antibiotic used in this procedure
  • In the tetracycline plates, the colonies are more distinct. Additionally, the tetracycline had several golden-orange colonies that were never found in the plates without tetracycline. This resembles a different type of bacteria presence. To the naked eye, without any specialized technology, there appears to be two types of bacteria present on the tet plates- the golden-orange colonies and white-grey colonies. On the other hand, there is only one on type of bacteria present- the grey-white colonies- present on the nutrient agar plates. However, this determination was made based on our perception of the color and shape of bacteria. I think the presence of this extra golden-orange bacteria presence is an immune-type response of the bacteria. There seemed to be no fungi present on any of the plates, but it is possible that fungi were mistaken to be bacteria on both the nutrient agar and nutrient agar plus tet plates. However, overall, the get plates had a fewer number of bacterial colonies, due to the fact that get is an antibiotic and is used to kill bacteria.
  • Only the 10^-3 and 10^-5 plates of nutrient agar plus tet had bacterial growth present. I believe this is because these are the more concentrated bacterial plates, so there bacteria were greater in number and strength, thus allowing them to flourish.
  • According to http://mmbr.asm.org/content/65/2/232.full, tetracyclines prevent the association of aminoacyl-tRNAs with bacterial ribosomes. This association is an incredibly crucial step of protein synthesis, hence tetracycline is used to prevent bacteria from creating proteins, which are needed for the bacteria to survive and reproduce. Tetracycline has been shown to kill many bacteria, a few of which include chlamydia, Rickettsia, and Mycoplasma.
  • -Observations of bacterial cell morphology:
  • Table 2: Information regarding the colonies' description, amount, cell description, and gram identification
  • -See https://docs.google.com/a/student.american.edu/document/d/1quTFWToA71lC_RlmLiccTdm7yJ8O5EzQB9b0BxkpUfI/edit

Conclusions: There was bacterial growth only on the 10^-3 and 10^-5 plates of both the nutrient agar and nutrient agar plus tet. Any lower dilution did not produce visible bacterial growth. This, I believe, is because the nutrient dilution was too low to allow the bacteria to strengthen and reproduce. Additionally, the bacteria couldn't survive on the 10^-7 nutrient agar plus tet plate because the get was too strong for the bacteria to fight. I believe that both our 10^-3 plates of nutrient agar and nutrient agar plus tet were infected with a Gram positive bacteria that colonizes in the form of streptobacilli. We think our 10^-5 plate of nutrient agar, on the other hand, were infected by Gram negative streptococcus. I'm not sure how the results varied between plates; I suspect an error was made in either spreading the bacteria or some kind of cross-contamination happened. Therefore, there are bacteria present that colonize in the form of streptobacilli and are resistant to tetracycline. (FINISH)


January 25th, 2014 Date observed: January 23rd, 2014

Goals/objectives: To understand how to use a dichotomous key and to understand the characteristics of Algae and Protists

Procedures:

  • -Procedure 1: Hay infusion culture continued
  • 1) The culture, without being disturbed, was brought to our group's lab space so observations of the physical appearance could be made
  • 2) A sample from the bottom, middle, and top layer were all drawn and made into a wet slide to be observed under a microscope. It is important to note where the organisms are found in order to help identify their nature. Some may be near or far from the plant matter based on how much they need the plant's nutrients
  • 3) The organisms found under the microscope were then described in terms of color, mobility, size, etc. and characterized with the help of a Dichotomous key
  • -Procedure 2: Preparing and Plating Serial Dilutions
  • 1) Four tubes of 10 mL sterile broth were obtained and labeled 10^-2, 10^-4, 10^-6, and 10^-8. A 100 mL micropipeter set and tips were also obtained
  • 2) 4 nutrient agar plates were obtained and labeled 10^-3, 10^-5, 10^-7, and 10^-9 with the date and group initials
  • 3) 3 agar plus tetracycline plates were obtained (labeled "T") and labeled 10^-3, 10^-5, and 10^-7 with the date and group initials
  • 4) The top was then placed on the Hay infusion culture and mixed until the solution was homogenous
  • 5) 100 micro liters of the mix were taken from the Hay infusion culture and added to the 10^-2 tube, then inverted several times
  • 6) 100 micro liters of the mix were taken from the 10^-2 tube and added into the 10^-4 tube, then inverted several times
  • 7) This was then repeated into the 10^-6 then 10^-8 tubes to make the respective dilutions
  • 8) 100 micro liters of the mix from the 10^-2 tube were added to the 10^-3 plates of both the nutrient agar and agar plus tetracycline
  • 9) The sample was then spread around the plate
  • 10) Steps 8 and 9 were then repeated with the 10^-4 tube onto the 10^-5 plates of both the nutrient agar and agar plus tetracycline, and the 10^-6 tube onto the 10^-7 plates of both the nutrient agar and agar plus tetracycline
  • 11) Steps 8 and 9 were then repeated with the 10^-8 tube onto the remaining 10^-9 plate of nutrient agar only
  • 12) The plates were then incubated at room temperature for 1 week

Observations:

  • -Observations of the transect: The transect is covered in several inches of snow from the storm on January 21st-22nd. There are several tracks of foot prints, both human and animal, throughout the transect.
  • -Observations of last week's Hay infusion culture:
  • Top layer: Brown leaf is floating on top, part of the flower bud is seen in the top layer, the top has turned into a gray-brown opaque film, there are few areas of transparency within the film, no apparent life is on the top unless the film is some sort of fungus
  • Middle layer: Composed of an amber-brown transparent liquid, most of the flower bud is in this layer, the piece of grass is submerged in this layer
  • Bottom later:Composed of a solid state, soil has all sunk down to the bottom, the wood chip is also on the bottom, dark brown in color
  • Other observations: The piece of grass is still green with no apparent loss of pigment, the flower bud has a white spiderweb-like growth hanging off of it, and there is no strong abhorrent smell present.
  • If the Hay infusion culture had sat undisturbed for another two months, I would expect the piece of grass to be completely dead, due to the lack of nutrients needed for photosynthesis. Additionally, I would expect the flower bud to have disintegrated, due to the harsh conditions of the culture. I would expect the whole culture to be a musty brown-black concoction, too harsh for anything to survive in.
  • The selective pressures of the Hay infusion culture include both the soil's nutrients for growth and survival and also the competition between light and water in overwhelming or saving the plant life. These things affected the composition and livelihood of our organisms.
  • -Observations of observed organisms under the microscope of the top layer with possible characterizations:

1) Algae

  • Large, green masses
  • Multicellular
  • Immobile

2) Paramecium Voritcella

  • 2.5 ocular spaces on 10x = 25 micrometers
  • Clear/colorless
  • Very small
  • Fast swimmer
  • Elongated body
  • Moves in a corkscrew fashion

3) Chlamydomonas

  • 1 ocular space on 10x= 10 micrometers
  • Appears to be a slight green pigment
  • Exhibits strange motions
  • Appears to be moved by flagella
  • Single cell
  • Oval shaped

4) Colpidium sp.

  • 20 ocular spaces on 40 x= 50 micrometers
  • Clear/colorless
  • Relatively small
  • Oval shaped
  • Fast swimmer
  • Entirely covered with cilia
  • Makes fast/rapid motions

Calculations:

  • -Microscope calculations:
  • 4x calculations: # ocular spaces x 25 = # of micrometers (not used in this lab)
  • 10x calculations: # of ocular spaces x 10 = # of micrometers (ex: Paramecium vorticella= 2.5 ocular spaces on 10x--> 2.5 x 10= 25 micrometers)
  • 40x calculations: # of ocular spaces x 2.5 = # of micrometers (ex: Colpidium sp.= 20 ocular spaces on 40x--> 20 x 2.5= 50 micrometers)
  • -Serial dilution calculations:
  • Started with 100 microliters of Hay infusion in 10 mLs of sterile broth= 1/100= 10^-2
  • Took 100 microliters of 10^-2 broth and put in 10 mLs of sterile broth= .01/10 = 10^-4
  • Repeated this procedure to make the 10^-6 and 10^-8 solutions
  • Took 10^-2 broth and plated on a nutrient agar and nutrient agar plus tet plate with 100 microliters already placed= .01/1= 10^-3 plates
  • Repeated with 10^-4 to make 10^-5; repeated with 10^-6 to make 10^-7; repeated with 10^-8 to make 10^-9 dilutions

Extra notes:

  • -One of the species that demonstrates the needs of life is the paramecium:
  • 1) Energy: Paramecium consume bacteria and algae for food, which it then converts into energy to survive
  • 2) Cells: Paramecium are composed of membrane-bound cells
  • 3) Information: Paramecium have DNA, the information that encodes its life
  • 4) Replication: Paramecium reproduce asexually during binary fission, in which they replicate their DNA and pass it into their genetically-idential offspring
  • 5) Evolution: Paramecium evolved from their first seen structure in order to feed and protect themselves
  • All information from: http://en.wikipedia.org/wiki/Paramecium


Photos: See https://docs.google.com/a/student.american.edu/document/d/1quTFWToA71lC_RlmLiccTdm7yJ8O5EzQB9b0BxkpUfI/edit


January 16th, 2014 Date observed: January 16th, 2014

Goal/objective: Find the designated transect and observe it. List the physical description, biotic, and abiotic factors of the transect. Also, create a Hay infusion culture to be evaluated in one week.

  • Biotic factors: Grass, leaves, soil, flowers, and bushes
  • Abiotic factors: Fertilizer, concrete bench, metal lining separating the soil from the walkway, "Freidheim Quadrangle" sign, and walkway stones
  • Description of area: This 20' by 20' square is located on the Quad in front of Hurst Hall. It's composed primarily of a spacious grass area. There is an arc of soil, including shrubbery and a portion of the "Freidheim quadrangle" sign. Between the soil area and the walkway is a metal lining. There are very few leaves or flowers left on the shrubbery, due to the extreme wintery conditions. Within that arc is another, smaller arc consisting of a stone walkway and concrete bench.

Procedure: Hay infusion culture

  • 1) 10-12 grams of our sample was weighed and placed in a labeled plastic jar with 500 mLs of Deerpark water
  • 2) 0.1 gram of dried milk was added and gently mixed up for about 10 seconds
  • 3) The top of the jar was then removed and the rest of the jar was placed on a lab table with other jar

Conclusions: There isn't anything that I would change for "next time" per se, but I think it would be interesting if we made two Hay infusions and put them in different environments with varying light exposure, temperature, or nutrients and compared later. The abiotic and biotic factors will play more of a role when the weather gets nicer. I expect to see the leaves and flowers budding within a few months. Also, I'm interested in seeing how the nicer weather attracts people to the transect and how they will play a role on the transect's being.

Photos: See https://docs.google.com/a/student.american.edu/document/d/1quTFWToA71lC_RlmLiccTdm7yJ8O5EzQB9b0BxkpUfI/edit

Personal tools