User:Alison R. Neuwirth/Notebook/Biology 210 at AU

From OpenWetWare

Jump to: navigation, search

February 9, 2016: PCR analysis of Transect 4 Bacteria

Purpose: The purpose of this experiment was to identify the bacteria within transect four using PCR sequencing of of the 16S ribosomal subunit gene. The 16S ribosomal subunit is particularly closely related to certain types of bacteria and therefore useful for identifying bacterial strains. This data was compared to other data regarding the bacteria from the lab, including colony formation.

Materials and Methods:

Bacterial colonies grown from the serial dilutions described in the January 22, 2016 entry were used to determine the sort of bacterial organisms that grew in the Hay Infusion. Gram stains were made of each colony, which were also observed microscopically. Samples for PCR were taken from the colonies which grew on 10^-3 plates for tetracycline and nutrient agar as the 10^-3 colonies had the most growth.

Two labeled tubes were made of PCR samples. Each tube container contained 20 ul of primer / water mixture as well as a PCR bead. A sterile toothpick was used to pick up a small amount of bacterial colony to characterize. This was mixed in the PCR tube for 5 seconds. A fresh toothpick was used for each colony. A week later a gel electrophoresis was run on the PCR. Samples were pipetted into the wells at the top of the gel using a P-100 pipette. The bacterial genes that separated well during electrophoresis, in this case, the nutrient agar 10^-3 plate, were sent away for sequencing analysis. These sequences were then analyzed using the NCBI "Blast" database.


Data:

Please see below an image of the class gel electrophoresis. The genetic material that was sent away from transect four had the column that was fourth from the right.:

Image:Geltransect4AU.png‎


The following was the sequence of the gene of the bacteria from our transect, the result of the 16S Sequence from Nutrient Agar Plate 10^-3 :

NNNNNNNNNNNNNGNNANNCNTGCAGTCGAGCGGTAGTCACNNNNAGCTTGCTCTCGGGTGACGAGCGGCGGACGGGTGA GTAATGTCTGGGAAACTNGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCA AAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAG GCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGC AGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTA CTTTCAGCGAGGAGGAAGGCATTGTGGTTAATAACCACAGTGATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCG TGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCA AGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGA ATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACG CTCANNTGCGAAAGCGTGGGGAGCAAACAGGNANNAGATACCCTGGTAGTCCACGCCGTNNCGATGTCGACTTGGAGGTT GTTCCCTTGAGGAGTGGCTTCCGGAGCTAACGCGTTAANTCGACCGCCTGGGGANTACGGCCGCANNGTTAAAACTCAGA TGAATTGACNGGGGNNCGCACAANCGGTGGNGCNNGTGGTTTAATTCGATGCAACGCGAANNANCCNTNACCTACTCTTG ACATCCNNANAACTTAGCNNNGATNCTTTNGTGCCTTCNNNAACTNNNNNNCAGGTGCTGCNNGGCTNTCGTCNNNCNTG NN

This sequence was used to identify the genus species by using the NCBI blast software, which "finds regions of similarity between biological sequences." (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Blast searched its known database of nucleotide sequences and found a match between this genetic sequence from transect four and a specific Enterobacteria sequence.

This sequence is a 96% match with Enterobacter sp. 2011SOCNI48. Enterobacteria are gram-negative, rod shaped bacteria (http://www.ncbi.nlm.nih.gov/books/NBK8035/).

Conclusion:

The findings of the gene sequencing generally align with our findings in lab in terms of gram stain and morphology. All of the bacteria we identified in lab were gram negative, as are Enterobacteria. Many of them were rod shaped, as are Enterobacteria. The primary way that the sequencing differs from what we saw in lab is the area of motility (http://www.britannica.com/science/Enterobacter). Enterobacteria are considered motile and have flagella. Under the wet mount, we did not see any motility in lab on our 10^-3 wet mount. It is possible that the movement could have been too small to notice, or that the sample on the wet mount did not have enough Enterobacteria bacteria for the movement to be noticeable.

The gene sequencing provided another way of corroborating our findings. In lab, we used gram stain and colony morphology in order to understand the sort of bacteria growing in our transect. Sequencing allowed us to identify a specific colony that grew as a result of our Hay Infusion sample.


-AN

February 9, 2016: The Implications of Alcohol Exposure on Fetus Development: Zebra Fish and Ethanol Experiment

Purpose: The purpose of this experiment is to investigate the impact of 1% Ethanol exposure on the development of Zebrafish, vs the development of Zebrafish in water. This study has larger implications as Zebra fish can be considered a model organism, and thus this study has implications for fetal alcohol syndrome.

The hypothesis of this experiment is that the control and ethanol group will experience equal rates of survival, but the ethanol group with experience increase morphological deformities such as lower heart rate and larger eyes vs. control.

Materials and Methods: 24 zebrafish at stage 13 embryo were placed in water, 24 placed in 1% ethanol solution, each grown in a separate dish and observed over the course of two weeks. The solution levels were maintained at 2mL and the fish were checked at least every other day to maintain water levels. Morphological change was noted on days 4 and 7. The temperature was maintained at the labs room temperature throughout, about 25 degrees celsius. The fish were kept in a shaded area, and the pH remained constant. These were all controls. The only difference between the treatment of the two conditions was the solution in which the fish developed: water or 1% ethanol.

Log of Visits:

2/19: Experiment Set Up, Stage 13-14 embryos selected

2/22 (Day 3): 43% of control have hatched, 52% of Ethanol have hatched. Those that have not yet hatched: All fish are at 48 hours hpf. Tails and eyes developed, whole fish still encased in chorion. It is 28 degrees celsius. Fish will likely be hatched by EOD. Fish development was likely delayed due to temperature during shipping. One fish in each condition is dead of fungus. 46 still alive.

2/23 (Day 4): All fish are hatched. 46 still alive. Day Four (2/23) : a more extensive examination of fish Morphology was taken, see the score card developed below. Notes on the Score Card:

  • Ethanol group fish were far less responsive to external stimuli. Whereas control group when poked would swim quickly away, ethanol fish would not move until polked continuously or sometimes simply rock back and forth.
  • Control - examined #19 at 4x objective
  • Experimental - examined #6
  • Hard to measure as swimming in a twitch like manner. Fins may have developed lopsided. Heart rate seems slower/ less visible. Altered rating to 6 as this guy is swimming around once under the scope, although less responsive in the petri dish.
  • added p100 of either condition to maintain levels
  • Mouth is developing but will be easier to measure later on. Swim bladder will develop next week

2/24 (Day 5): Fish Fed. 46 still alive.

2/26 (Day 6): 46 alive. 12 in control deformed and has no color. This is an anomaly. He may have gone through shock in transportation. 1-3 in control and experimental preserved

2/29 (Day 10) : Three more fish preserved in each condition. Two more dead in ethanol, no more dead in control. The mutations observed were similar to previous weeks, EtOH condition had slower fish with less reaction and slower heartbeats.

3/1 ( Day 11) : 5 dead from experimental group. 2 dead in control.

3/3 (Day 13) : Only 6 fish remain alive, 2 control fish, 4 EtOH.

3/4 (Day 14) : Only one fish remains alive, one EtOH fish. This is the last day of the experiment. A range of measurements were taken of the fish that had been preserved, as well as the last lone surviving ethanol fish.

Score Card:

Day Number 4 4
Control / Experimental Control Experimental
Number of Dead Eggs 11
Number of Living Embryos still in Egg Case 00
Number of Dead Hatchlings 00
Degree of Body and Tail Pigmentation (1-5), 5= Highly Colored5
Eyes Size (Normal/Abnormal) 13 ocular spaces at 4x 13 ocular spaces at 4x
Eye Movement (Fast/ Slow) occasional, shifting occasional, shifting
Heart / Heart Rate Notable and quick far less visible heart rate, more of a quiver
Pectoral Fin Development Small pectoral fins (see through), fluttering lopsided fin movement (moves more on one side), fluttering
Yolk Sac Size (absorbed by Day 5/7 ) 20 ocular spaces 20 ocular spaces
Development of Swim Bladder N/A N/A
Development of the Mouth (protruding Jaw) Visible Visible
General Development, Startle Response (1-10, 10 = Highly Responsive) 106


Conclusion, End of Week One : Thus far, the zebrafish have similarly low rates of mortality, which aligns with scientific literature. However, when examined under the compound microscope, significant differences are starting to emerge. The zebrafish exposed to ethanol looked like it had a malformed fin, and had a more subtle heartbeat than the control zebrafish. In the original petri dish, it appeared that the ethanol zebrafish had slower startle responses than the control zebra fish overall. However, the ethanol zebrafish examined under the compound microscope on day four was highly alarmed and would not stop swimming once startled, demonstrating his ability to swim.


Conclusion, End of Week Two: Throughout, the experiment and control groups had fairly equal rates of survival, which tailed off equally at the end. The largest difference between the two groups was in the startle response. The control fish consistently had a stronger startle response than the Ethanol fish. The final day (4/4) of the experiment we took a number of measurement of all fish that had been preserved, which will be reported in our final lab report. There do appear to have been some differences between groups there, but the numbers are still being analyzed.

-AN



February 12, 2016: Identification of Invertebrates and Vertebrates from Transect 4

Purpose: The purpose of this lab was to learn to identify types invertebrates and vertebrates from the Berlese funnel using a dichotomous key within our transect. Additionally, we learned how to identify and describe the morphological diferences between acoelomates, pseudocoelmoates and coelemates as well as between radial, bilaateral and no symmetry.

Materials and Methods:

  • Two plastic bags
  • Samples from five plants from transect
  • 500 grams of leaf litter
  • Dissection microscope
  • Glass slides
  • 50:50 water ethanol solution
  • Parafilm
  • 40 watt lamp
  • tape
  • 50 ml conical tube
  • screening material
  • foil
  • Berlese funnel
  • ring stand

Invertebrates collected with the Berlese Funnel were analyzed. The Berlese funnel was broken down by pouring 15 mL of 50% ethanol and organisms into a petri dish, and the remaining liquid into another dish. Organisms were identified using a dissection microscope and identified using a key.

Data:

Table 1: Invertebrates found in in Transect Four

Organism (Phylum and Class) Length in mm Number in Sample Description of Organism
Arthropod, Insect 31little fly, has wings and antennae
Arthropod, Insect 21looks like lice, pointy head and curved back
Arthropod, Insect 2.51flea, compressed legs used for jumping

Table one compiles information regarding the invertebrates found in the transect. Three Insects were identified from the transect. There was one of each. One was a fly, identified via wings and an antenna. One was lice, identified via pointy head and curved back. A third, a flea, was identified through compressed legs used for jumping. All were 2-3 mm in length, with the lice being the smallest. As there was only one of each, they were all equally common within the transect.

Please see an image of the Lice below:

Image:Lice.png

Please see an image of the Flea from the transect below:

Image:Flea.png

The five vertebrates that might live in the transect, with their full classification, in this Transect include (All Taxonomy found in ADW, Citation #2, all animals identified via citation #1) :

Vertebrate Barn Swallow Red Winged blackbird Muskrat Painted Turtle Koi Fish
Phylum ChordataChordataChordataChordataChordata
Subphylum Vertebrata Vertebrata VertebrataVertebrataVertebrata
Class Aves AvesMamallia ReptiliaActinopterygii
Order Passeriformes PasseriformesRodentia TestudinesCypriniformes
Family HirundinidaeIcteridaeCricetidaeEmydidaeCyprinidae
Genus HirundoAgelaiusOndatraChrysemysCyprinus
Species Rustico Agelaius phoeniceusOndatra Zibethicus Chrysemys pictaCyprinus Carpio


Koi inhabit the transect as the pond is a Koi pond. The other four were identified as common to non-tidal wetland environments such as our transect. (Citation 1)

These invertebrates would flourish in transect four due to the abundance of biotic and abiotic factors. All facts about animal diet taken from (Citation 2):

Muskrat: Primarily an Herbivore, though they also eat animals. Would feed on plants in transect.

Koi fish – Omnivores, feed on different food at different stages of life. They generally eat insects, terrestrial worms, plant foods and algae. Painted turtles – feed primarily on plants. Will also eat fish and some insects, which were found in our Berlese funnel. The will also eat algae.

Barn swallow- Feel mainly on flying insects. They drink water by barely touching the surface with their beak while in flight.

Red-winged blackbird – eat plants when not in breading season and animals in breeding season, both of which can be found in transect four. Will eat anything from birds to insects.

Please see below a food web constructed based off of the above information, as well as pages 1150-1151 of the assigned Freeman text.

Image:Foodwebtranect34033au.jpeg‎

At the bottom are the primary producers, the plants that fuel the rest of life on earth. Without the primary producers, nothing else would be possible. Here, the painted turtle and the muskrats feed directly off of the producers. Protists are often photosynthetic, but others feed off of bacteria and algae. As the trophic levels move up, the lines become increasingly intertwined. The red winged blackbird eats both the flea and the earthworm, but it also eats primary produce, particularly dead leaves and soil (Wohlgemuth 1991).

Conclusion: All organisms identified were Anthropod Insects ranging from 2-3 mm. With our previous findings, they give a fuller picture of Transect four, and allowed the construction of a food web. Together, these organisms fulfill the ecological concepts of “community,” “carrying capacity,” and “trophic levels.”

The food web itself depicts a community, a group of organisms interacting with each other in a particular space and time. Transect four has a specific carrying capacity, a limited number of organisms that it can support, as does every ecological system. The trophic levels in the diagram are represented by the place that each organism has on the food chain, and it refers to the organisms’ position in the system.

Citations: http://ccrm.vims.edu/publications/wetlands_technical_reports/91A.pdf http://animaldiversity.org/accounts/Agelaius_phoeniceus/


-AN

February 5, 2016: Identification of Plantae and Fungi from Transect 4

Purpose: The purpose of this lab was to learn to identify types of vascularization, specialized structures, and mechanisms of reproduction within plants as well as differentiate between Fungi sporangi. These skills were then used to identify plants and fungi found in our transect.

Materials and Methods:

  • Two plastic bags
  • Samples from five plants from transect
  • 500 grams of leaf litter
  • Dissection microscope
  • Glass slides
  • 50:50 water ethanol solution
  • Parafilm
  • 40 watt lamp
  • tape
  • 50 ml conical tube
  • screening material
  • foil
  • Berlese funnel
  • ring stand

The two plastic bags were used to gather samples from five different plants from the transect as well as 500 grams of leaf litter to use to set up the Berlese funnel . The five plants investigated from transect four were a 4x4 ft round bush, a 1 ft long tufted grass, a 1 inch tall grass, a 2x3 rectangular bush, and a 3 inch tall pronged green shoot. Each plant from the transect were vascular. The first sample, the round bush, had two samples taken from it, a leaf and a flower. All other plants had one sample taken. These samples were then dissected and then examined under the dissection microscope in the lab. This allowed for the specialized structures, methods of reproduction, and genus of each plant to be determined, please refer to table 1. Samples from fungi in the lab were also examined.

In order to prepare for the next week's lab, a Berlese funnel was set up to collect invertebrates from the leaf litter from the transect. 25 ml of a 50:50 ethanol/water solution was poured into a 50ml conical tube. Screening material was fit into the bottom of the funnel to prevent leaf litter from falling into the preservative. The leaf litter sample was put into the top of the funnel. The funnel was set on top of the ring stand so that it could be held onto the ethanol tube. The tube was then connected with parafilm onto the base of the funnel. A 40 watt lamp was placed above the funnel with a bulb about 1-2 inches from the top of the leaf litter. The entire complex was covered in foil for one week.

Data:

Table 1: Characteristics of Plants Collected from the Transect

Transect Sample Plants Location and # in transect Descripton (Shape and Size) Vascularization Specialized Structures Mechanisms of Reproduction
#1East4x4 ft round bushDicot StomataSeeds/ Pollen
#2Northwest 1 ft long tufted grass Monocot StomataSeeds
#3South 1 inch tall grass Monocot StomataSeeds
#4West 2x3 ft rectangular bush Dicot StomataSeeds
#5West 3 inch tall pronged green sprout Monocot StomataSeeds

Table one complies the data regarding the five plants found for our transect. The five plants investigated from transect four were a 4x4 ft round bush, a 1 ft long tufted grass, a 1 inch tall grass, a 2x3 rectangular bush, and a 3 inch tall pronged green shoot. Sample one, the round bush, was green and alive. A red flower was taken from it and investigated in the lab, identifying the bush as dicot. The bush’s leaves also followed a dicot pattern. None of the other plants had seeds or flowers. The plants were identified as monocot or dicots based on their leaf structures and vascular bundles. The genus of the plants was identified by dichotomous key. It is likely that the grass, Plant #3, was one native to the DC or Virginia area, such as the Elymus hystrix (1). Plant #2 may have been Carex pensylvanica (1). Sample #1 was found in the East of the Transect, #2 in the Northwest, #3 in the South, and #4 and #5 came from the West. Leaves from Plant #1 were simple, convex, and entire. Leaves from plant #2 were long, linear and entire. Leaves from were plant #3 short, linear, and entire. Leaves from plant #4 were elliptic and whorled. Leaves from plant #5 were linear and entire (2).

Please see images of each plant as well as the leaves from the plants below.

Plant #1

Image:Specimen_1.jpg


Plant #2


Image:Specimen_2.jpg


Plant #3


Image:Specimen_3.jpg


Plant #4


Image:Specimen_4.png


Plant #5


Image:Specimen_5.jpg


Image:IMG_1409.jpg


Fungi sporangia are the structures that produce fungi spores. They are formed by hyphae. The spores are released when the sporangia open. There are three major kinds of fungi: zygomycota, basidiomycota, and ascomycota. Of the samples in lab, one was a mushroom, a kind of basidiomycota. One, sketched below, was a form of mold, ascomycota.

While plants and fungi have different morphologies, they also share some commonalities. They are both eukaryotic and multicellular. They reproduce via spores or seeds. Their unique morphologies reflect the fact that they have different roles within the greater world, plants are autotrophic and photosynthesize, fungi are symbiotic and saprophytic.


Image:IMG_1472.jpg


Conclusions: This study found that there were all five plants in transect four were angiosperms and vascular in nature. Two were dicot, three monocot, and all used seeds as a method of reproduction. The only specialized structures identified through the dissection microscope were stomata, however stomata are always attached to other specialized structures in plants including guard cells and parenchyma. The fungi in lab were identified as basidiomycota and ascomycota. A Berlese funnel was set up to collect invertebrates for next week's lab.

  1. https://www.cs.rochester.edu/users/faculty/nelson/wildflowers/glossaries/leaves/index.html#structure [Website]
  2. https://www.novaregion.org/DocumentCenter/View/10615

    [Website]

-AN

January 29, 2016: Identification of Hay Infusion Bacteria

Summary: Bacteria from the Hay infusion will identified through four different methods: motility, gram stain, colony morphology, and the sequencing of the 16s ribosomal subunit gene. The outcome of the gene sequencing will be determined next week. After samples were taken in order to identify bacteria according to each method, the one last observation was made of Hay Infusion Culture. One it's third week, the Hay Infusion looks incredibly mold. It has a thick, dark green layer of mold and the top, and it's waters are a deeper, brown green. The smell still smells akin to a natural body of water. It is possible though unlikely that Archaea species will have grown on the agar plates made from our Hay infusion. Archaea are often found in extreme environments, such as in the mouth of a geyser. The land on AU's campus where were took our sample for the Hay Infusion was by no means an extreme environment. However, Archaea will sometimes be found outside of such environments, so it is possible though highly unlikely that we will find some on our Aloe plates (1).

Materials and Methods: Bacterial colonies from the serial dilutions described in the January 22, 2016 entry were used to determine the sort of bacterial organisms that grew in the Hay Infusion. The colonies were observed overall in order to help identify the organisms. Bacteria organisms were examined microscopically from the following nutrient agar plates: 10^-3, 10^-5, 10^7 as well as the tetracycline plate that grew colonies, 10^-3. Bacteria were observed and identified morphologically on wet mounts at a 40x objective. Gram stains were made of each colony, which were also observed microscopically. Lastly, PCR was set up for amplification of the 16s ribosomal subunit gene, which is specific to each bacterial species. Samples for PCR were taken from 10^-3 colonies for both tetracycline and nutrient agar.

Results: Please see the results of the bacterial growth over one week on the aloe plates below. The growth of bacteria was significantly inhibited by tetracycline. Only one tetracycline plate, 10^-3, the one treated with the least antibiotic with the least antibiotic, had any bacterial growth. Even so only 40 bacterial colonies grew, which was far less than the impressive growth on the 10^-7 and 10^3 nutrient agar plates, which grew 1232 and 912 colonies, respectively. There were three types of colonies on the agar plates. The 10^-3 and 10^-7 nutrient agar plates had very small, circular, whitish yellow colonies. The colonies that grew on 10^-9 and 10^5 and the 10^-3 tetracycline plate were much larger, and there were less of them. These colonies were also round, but they were more raised, nearly convex, and had a lobate edge. The third type of colony was bright orange, round, convex, and only three grew on the 10^-5 nutrient agar plate. While there were three types of colonies among the nutrient agar plates, only one kind grew on the tetracycline plate, which means that the tetracycline inhibited growth of 2/3 of the bacterial colonies present in our Hay Infusion, and was able to prevent the growth of the the one bacteria that did grow at a higher dilution. As no bacteria from our sample was able to grow beyond the lowest dilution of tetracycline, no species of bacteria from our samples was unaffected by tetracycline.

After gram staining, all bacterial samples from our aloe plates were determined microscopically to be gram negative, indicating that they have less peptidoglycan in their cell walls than gram positive bacteria (American Biology 210 Lab Manual, 40). The gram negative bacteria from our samples were very responsive to tetracycline, which has the ability to inhibit the growth of both gram negative and gram positive bacteria (2). Tetracycline prevents bacterias from creating proteins, which are central to all cell function (2).


Table 1: 1000- Fold Serial Dilutions Results

Dilution Agar Type # Colonies on Plate Conversion Factor Colonies / mL
10^-3Nutrient91210^39.12E+05
10^-5Nutrient3410^53.40E+06
10^-7Nutrient123210^71.23E+10
10^-9Nutrient310^93.00E+09
10^-3Nutrient+ tetracycline 4010^34.00E+04
10^-5Nutrient+ tetracycline 010^50.00E+00
10^-7Nutrient+ tetracycline 010^70.00E+00
10^-9Nutrient+ tetracycline 010^90.00E+00


Table 2: Bacteria Characterization

Colony Label Plate Type Colony Description Cell Description Gram +/-
10^-3NutrientSmall, circular, whitish yellowNon-mobile Coccus and Bacillus -
10^-5Nutrientlarge, convex, white, lobate Mobile coccus cells -
10^-7NutrientSmall, circular, whitish yellowMobile coccus cells -
10^-3Tetracycline large, convex, white, lobate Non-mobile Coccus and Bacillus -


Please see all wet mount organisms viewed microscopically in Figures 1-4 below:



Image:Bacteria_Figures_2.jpg


Please see an image of the wet mount of tetracycline 10^-3, viewed through the microscope, below.


Image:Wet_Mount_Tet_10^-3_2.jpg

Please see an image of the wet mount of Nutrietn10^-3, viewed through the microscope, below.


Image:Nutrient_10^-3_2.jpg

Conclusions: The bacteria from the Hay Infusion of Transect four were found to be gram negative, produce coccus or bacillus colonies, and responsive to tetracycline. When observed under the microscope on a wet mount, the bacteria from 10^-7 and 10^-5 nutrient agar plates were mobile. The bacterias species will be further determined when the results of the samples for PCR which were taken from 10^-3 colonies for both tetracycline and nutrient agar come back.

- AN

  1. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC99026/ [Website]
  2. http://www.ucmp.berkeley.edu/archaea/archaea.html

    [Website]

January 22, 2016: Identification of Hay Infusion Algae and Protists

Summary: Organisms from three niches within the Hay infusion were identified. Our Hay infusion had a natural smell to it, akin to a pond or other body of water. It had a distinct top layer which was foamy where it contacted the edge of the container. Signs of life visible to the eye without a microscope included a faint greenery, suggesting mold, on the surface of the water. The middle of the infusion was translucent and seemed to hold no solid. The majority of the sediment seemed to lay at the bottom of the the container in a thick sludge. Organisms which grow close to plant matter may differ from organisms which grow away from plant matter as organisms adapt to their environment. Organisms whose environments contain plant matter may use that matter for food or shelter, while organisms that live away from it may rely on other means of survival. Generally speaking, organisms stay in step with their niche, and selection favors those that utilize the resources around them well.

Materials and Methods: Samples were drawn from three different niches of the infusion, surface film, middle, bottom soil, while retaining the rest of the infusion in tact. The samples were then plated an observed under a microscope. Organisms were identified using a dichotomous key. The organisms were then measured using the ocular micrometer. Please see sketches of the organisms identified below. The Hay Infusion of Transect four revealed diverse life within each sample. Haemeatoccous, a non-motile , photosynthetic algae lay on the bottom, with cells ranging in size from 20-300 micrometers. In the middle, fast moving colpidium, a protozoa, measured 20 micrometers. The top layer of the Hay Infusion sprouted Gloeocapsa, motile, photosynthetic algae, measuring five micrometers.



Image:Revised_Samples_Final.jpg

Colpidium meet all the needs of life: Energy, Cells, Information, Replication, and Evolution. Colpidium belong to the Alveolata lineage of protists. Colpidium, like other protists, derive energy by ingesting other organisms. They are unicellular organisms, and a cell membrane provides the basis for their internal regulation. Colpidium, like all other organisms, process genetic code which they pass on to their offspring and which allows them to respond to their environment. Colpidium have plenty of options when it comes to replication. According to "Biological Science" by Freeman et. al, protists have the ability to reproduce asexually and sexually, though they undergo asexual reproduction far more often. As with every other organism on earth, Colpidium have evolved and are evolving. They have been shaped by their current environment as well as all the ones before it.


If the Hay Infusion Culture "grew" for another two months, the organisms in the culture would face increasingly limited resources. They would lack fresh water, some of the original infusion would have decayed, and any growth would lead to increased competition for space within a tiny plastic bottle. Ultimately, many of the organisms would die due to these increased and unique pressures. I believe that the algae would be the most likely to thrive, especially if the Hay Infusion were placed somewhere in view of the sun where they might perform photosynthesis. The algae are able to feed themselves, which is an incredibly powerful resource.

Please see a picture below of the serial dilution procedure used to prepare agar plates in order to analyze the bacteria present in the Hay Infusion. Eight agar plates were created, four nutrient agar, four nutrient agar plus tetracycline.

Image:Serial_Dilution_Sketch_Final.jpg‎


The three samples taken from the Hay Infusion proved rich with life, both protists and algae. Future analysis will surely reveal even more within what began as a twelve gram sample taken from a quiet part of the American University campus.

- AN


January 15, 2016 : Introductory Observations of Transect 4

Summary: This lab involved observation of transect 4 on the American University Campus, a 20 by 20 foot area of land which will be further analyzed over the upcoming weeks. Transect four is located in between the School of International Service and one of the dorms at American University. Though it is just feet away from the center of campus, it has a quiet, almost forgotten feel to it. Sitting on the bench just beyond the transect's pond feels like the sort of place one could read undisturbed. The transect has a slight hill to it, the pond, to the North, is lower than the tree and bushes located to the South. From an ecological perspective, the transect is the fascinating in that it has both a freshwater environment as well as rich soil, growing flowers, and bushes. Samples were taken from throughout the transect and a hay infusion was set up to observe protists and invertebrates from the transect area.

Materials: Sample from the transect, plastic jar, Deerpark water, dried milk.

Methods: A 12 gram sample from the transect including soil, vegetation, and pond water was mixed with 500 mLs of Deerpark water and .1 grams of dried milk for 10 seconds. The jar was lidded and left for one week.

Data: The Images and sketch attached to this entry as well as observational data. The transect had many abiotic and biotic components. Abiotic factors included soil, a pond, rocks, a grate, a net over the pond, and benches. Biotic factors included: trees, bushes, flowers and a range of live organisms which were not visible to the naked eye.

Image:SketchTransect4.jpeg‎

Image:Transect4Pond.jpg

Image:Transect4Grass.jpg

Conclusions: Transect 4 had a range of biotic and abiotic factors and appears to be a biologically rich environment. Future investigation will further reveal the inhabitants of this niche within the AU campus.

-AN

Personal tools