User:Alexander S Mikheyev/Notebook/rotifer alien genes/2010/03/26

From OpenWetWare

Jump to: navigation, search
Alien genes Main project page
Previous entry      Next entry

Contents

HCO LCO Screening

Test Ramp PCR on Cultured samples 1-7

Reaction mixture conc. 1x 10 '
Template Instagene?1
TopTaq buffer10x110
dNTP mix10 mM each0.22
Primer mix5 uM each110
TopTaq (QIAGEN)5U/ul0.050.5
Milli Q water6.7567.5
10 ul909.0ul / RXN
*Control AV 1ng/ul
PCR cycle
94C3 min
94C10 sec
45-68C3 min
RAMP 0.5C/sec
x35
68C5 min
AMP Lane Template '
1BaltimoreA1
2BaltimoreB1
3BaltimoreC2
4BaltimoreC3
5E. WindsorA1
6E. WindsorA3
7E. WindsorB1
8AV Positive Control

Load 1.0ul sample Image:26mar10 LCO HCO.jpg

Alien Genes New Primer Screen

Reaction mixture conc. 1x x32.5 ' Lane Gene Lane Gene
Temp (E. Windsor C3, 70)??2651AV1015817AV10084
TopTaq Buffer10x132.52AV1015318AV10082
dNTP mix10 mM each0.26.53AV1015119AV10075
Primer mix5 uM each14AV1015020AV10071
TopTaq5 U/ul0.051.6255AV1014021AV10045
Milli Q5.75186.8756AV1013422AV10043
10 ul7AV1013023AV10042
8AV1012324AV10041
PCR cycle9AV1012125AV10034
94C3 min10AV1010426AV10028
11AV1010927AV10027
98C10 sec12AV1009928AV10025
60C3 min13AV1009829AV10016
x3514AV1009430AV10011
15AV1009231AV10007
72C5 min16AV1008932AV10002
Reaction mixtureconc.1xx16.5No.SampleLaneGene
Temp (73, 74)??23373Ithaca 1 C21AV10134
TopTaq Buffer10x116.574Pennsylvania (PA) D52AV10121
dNTP mix10 mM each0.23.33AV10084
Primer mix5 uM each14AV10045
TopTaq5 U/ul0.050.8255AV10044
Milli Q5.7594.8756AV10034
10 ul7AV10027
8AV10025
PCR cycle
94C3 min
98C10 sec
60C3 min
x35
72C5 min

Loaded 2.0ul of each sample

Image:0050-1.jpg

Testing new primers on ricciae and vaga

These primers were designed to amplify all four copies of the gene, using data from A. vaga and P. roseola.

Reaction mixture conc. 1x 21
water7.25152.25
TopTaq buffer10x121
dNTP mix10 mM each0.24.2
Primer mix5 uM each0.5
TopTaq (QIAGEN)5U/ul0.051.05
template20 ng/ul0.5-
8.5
  • PCR conditions 95C 3m (93C 5s;60C 1m)x35

Primer sequences

hsp82_f1TCAATACATTTTACYCGAACAAAGAAA
hsp82_r1ATTCCCAAACATATTGTTCATCATC
hsp82_f2TTATATGACTGAACCAATCGATGAA
hsp82_r2TAGTAGCTGACCAACCATATTGTGA
myosin_f1TTGATGAAGCTAAACAAGTCTTCG
myosin_r1TCAAGTTTTTCAGCCATAGCAAC
myosin_f2CCCAGTGATAAAGTTGATGAAGCTA
myosin_r2TCAAGTTTTTCAGCCATAGCAAC
PMCA_f1GTATTGCAAAATTTCTTCAATTTCA
PMCA_r1ATCGATTTTGTWCGWCCNTA
saicars_f1CRAAAATGTACAATGATWCCWATTC
saicars_f2ACCATCCANARATGTTCGAG
rho_f1GCTAAATTATCYGYATCCATTTTTG
rho_r1AATATGGTTCAACATTTGTTGGTTT
s15a_f1GAAAAACGYCACAAACGTCAAGT
s15a_r1TGGTAAAAGATTATTAGTCCAAGTT
histone_f1ACCTTTACCACCTTTACCACGTC
histone_r1GTCGATTTTTGATAACGACGAATTT
histone_f2TTTTCAAGAAAGATTTTRAGAACACC
histone_r2GTAATTCRGTCGATTTTTGATAACG

Gel

  • Unless specified, the order of the sapmles is ricciae then vaga
  • all of the primers worked, except sacairs and a15, which did not cross-amplify
  • maybe should also try them on Philodena?
Personal tools