User:Ajayi Pickering-Haynes/Notebook/Biology 210 at AU

From OpenWetWare

Jump to: navigation, search

MB10: NNNNNNNNNNGNAGCNNNNNNNNAGTCGAGCGCCCCGCAGGNNAGCGGCAGACGGGTGAGTAACGCGTGGGAACGTACCT TTTGCTACGGAATAACTCAGGGAAACTTGTGCTAATACCGTAGGTGCCCTTCGGGGGAAAGATTTATCGGCAAAGGATCG GCCCGCGTTGGATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGACTATCCATAGCTGGGCTGAGAGGATGATCAAC CACACTGGGACTGAAACACGGCCCANACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATC CATCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTCACCGGTGAAGATAATGACGGTAACCGGAGAA CAAGCCCCGGCTAACTTCGTGCCAACAGCCGCGGTAATACGAAGGGGGCTAACGTTGTTCGGATTTACTGGGCGTAAAGC GCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTTTGATACTGGAAGTCTTGAG TATGGTANAGGTGAGTGGAATTCCGAGTGTANAGGTGAAATTCNTANATATTCNGAGGAACACCAGTGNNGAANGCGGCT CACTGGACCATTACTGACGCTGANGTGCNAAAGCGTGGGGAGCAAACANGATTANATACCCTGGTAGTCCACGCCGTANA CGATGAATGTTAGCCGTTGGGGAGTTTACTCTTCGGTGGCGCAGCTAACGCATTAAACATTCCGCCTGGNGAGTACNGTC GCAAGATTAAAACTCANANGAATTGACNGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCNAANCAACGCNCAAA CCTTACCANCCCTTGACATACCGGTCGCGGACACAGANATGTGTCTTTCANTTCNNCTGGACCGGATACANGTGCTGCAT GGCTGTCNTCANCTCGTGTCNNGAGATGTTGNGTTAAGTCCCNGCAACGANCGCAACCCCTCNNCCTTANTTGCCAGNNT TTANNTGGNCACTCTANNN

MB11: NNNNNNNNNNNNNNNNTNGCNNNGCAGTCGNNNNNNNNNGNNAGGNNNNNNNCTTGCTGCTTCGCTGACGAGTGGCGGAC GGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAA GACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCA CCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAG GCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTA AAGTACTTTCAGCGGGGAGGAAGGCGATGTGGTTAATAACCACGTCGATTGACGTTACCCGCAGAAGAAGCACCGGCTAA CTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTC TGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGGCAGGCTTGAGTCTCGTAGAGGGGG GTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAANGCGGCCCCCTGGACGAAGAC TGACGCTCANGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTTGG AGGTTGTGCCCTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAGTCGACCGCCTGGGGAGTACGGCCGCAANGTTAAAAC TCNNTGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCNATGCAACGCGAAGAACCTTACCTGGTCT TGACATCCACAGAACTTNNNCAGANATNGNNNNGGTGCCNTTNNGGAACTGTGANACAGGTGCTGCATGGNTNNCGTCAG CTCGTGNTNNTGAAANNNNN

Conclusions and Discussions: MB10 Sequence was used in the Blast software, since transect 2 was the environment under study. Our nucleotide sequence resulted with a Ochrobactrum which is gram negative, has short rods, and has straight like structure. Though our PCR amplification was not successful, similar to this new observation the sample we loaded Tetracycline 10^-5 confirmed to be gram negative via gram staining procedures. However, in terms of morphology we accounted for a circular shape but literature suggest that this bacterium has a straight shape. This bacteria is also motile, as predicted through observation and confirmed by literature. Overall our MB10 sequence and Tetracycline 10^-5 sample were synonymous with gram stain but differed in terms of shape. The MB11 Sequence confirmed to be a Salmonella bongori bacterium that was also confirmed to be gram-negative by existing literature. It is also a bacillus bacterium, which means it is rod-shaped. This observation coexists with our observation of the Tetracycline 10^-5 plate both in terms of gram stain and shape. However, since we were not able to carry out our PCR amplification due to lack thereof we can only predict this linkage based on the science. Overall, our predictions were generally similar to the bacteria confirmed in the nucleotide blast sequences, in terms of gram-stain being negative for both bacteria and the teracycline 10^-5 plate.

Transect #2 Lab 1 : Transect Observation and Hayculture

Transect #2 was in the Amphitheater area of the American University campus. It was located in the front of a building containing a stream in the central of its location. It was surrounded by several trees, shrubs, plant life, soil, rocks, and dirt. The stream was constantly flowing with rocks, soil, and a green pigment which suggested a presence of algae or protists. The biotic elements of our location are all the natural life components like trees, microorganisms, and other plant organisms. The area also contained an abundance of abiotic factors that stem from sunlight to the soil, and the temperature which was rather cold in despite of the sun being out. The transect was considerably rocky containing a pathway of rocks from its opening to the stream that existed in the middle. On the outskirts of the transect were colonies of different plant life, bare trees, and the ground was filled with leaves and branches. In essence the topography of the transect was a square solid structure where the stream lay ahead from west to east, the pathway of rocks went from south to the north, and the building behind our transect marked the northern location. Image:img_1275.jpgImage:img_1278.jpg Image:img_1279.jpg Image:img_1281.jpg Image:img_1282.jpg

Lab 2 : Protist & Algae Identification

Description: Our Hay Culture Infusion was made from Transect 2 which was by the Amphitheater of the American University. It was made from a collection of dirt, soil, and the environment from our area. The Culture was made from our sample outside, with 500 milliliters of water, 0.1 grams of dried milk, and laid out to settle for approximately a week before observation. Upon observation of the culture we observed a rather dark pigment filled with mold and a large amount of protists and algae. This confirmed that life was apparent within the sample. Our culture contained a strong acrid smell, and appeared to be harmful and pathogenic to the eye.

Image:IMG_1350.jpgImage:IMG_1351.jpg


Materials & Methods: Our first niche was taken from the bottom of the Hayculture which contained mostly dirt and a few moving organisms apparent. After taking a went mount sample of that niche, we used a microscope to observe features that would allow us to classify the organisms and learn about its specialized characteristics. Niche #1 from the bottom of the hayculture proved to be a form of Algae, formally known as Chlamydomonas. Through use of our dichotomous key, after first observing that our sample was green, we followed the pattern and confirmed that it was a grass-green color, a free swimming algae with flagella, and that the cells were solitary and globular which led us to classify this Algae as Chlamydomonas. Next, we choose a sample from the middle of the culture which was labeled as niche #2. This sample also proved to be an Algae, formally known as Chlamydomonas as well. Containing the same size and appearance as sample 1 with a green pigment and solitary motile characteristics, we concluded this to be the same through the use of the key again. Lastly, we drew a sample from the top of our Hayculture which we labeled as niche #3. This sample turned out to be a Protist in contrast to the other two, formally known as Peranema. Following our key, we observed that it was colorless, exhibited a differing form of motion, contained no presence of cilia, was all single, motile cells in the sample, contained one observed locomotor flagella, and appeared very vibrantly when in motion. These characteristics led us to the conclusion that this Protist was Peranema specifically. To conclude these observations we made serial dilutions to plate organisms present in our cultures on nutrient agar and tetracyclin plates.

Image:IMG_1352.jpg Image:IMG_1353.jpg


Organisms Identified & Serial Dilution Pictures:

Image:ajayiserialdilution1.jpg


Image:ajayiperanema.jpg

Image:ajayichlamydomonas.jpg


Conclusion: Upon observing under the microscope and use of the dichotomous keys, we included that our transect is indeed a rather diverse environment containing Algae and Protists based on our Hayculture sample. After taking samples from various niches (locations) of our Hayculture we concluded that it contained Chlamydomonas and Peranema. The morphological characteristics of these organisms allowed us to use the keys provided to come to these conclusions.


Lab #3 - Microbiology & Identifying Bacteria

Hay Culture Observation: Much of the Hay Culture stayed the same. However the smell became stronger and more acrid, which could account for the growth of more micro-organisms. As temperature has an ideal effect on growth, the lab environment might have caused these slight changes to our Hay Culture. The agar plates are used to test the presence of bacteria and thus Archaea would probably be unlikely to grow on the plates because they are metabolically different, and thus the presence of Archaea might have to be tested differently.

Introduction: Bacteria are diverse in shape, metabolism, and function. Through morphological observation bacteria can be identified. The three basic shapes are bacillus which are rod-shaped, coccus which are spherical, and spirillum which are twisted spiral (Bio 210 Laboratory Manual). Another morphological characteristic commonly used by scientists is the stain of bacteria which reflect the presence of peptidoglycan in the cell wall of bacteria. Bacteria are considered to be gram-positive, when they have a thicker presence of peptidoglycan with a blue stain and gram-negative when less peptidoglycan is present with a pink stain apparent on the microscope. In addition to these morphological observations, through the use of a polymerase chain reaction bacteria's metabolic activity can be determined by observing the difference that lie in DNA sequence among the genes of different bacteria. In this lab procedure, it is predicted that a myriad of diverse bacteria will be observed from our Hay Infusion Culture which reflect that transect 2 contains a diverse collection of abundant life.


Methods & Materials: First, transect 2 Hay Culture was observed for any changes in appearance, smell, or distinct features. Thereafter, the agar plates made the week before were observed. An estimation of colonies on each plate were recorded and the elevation and shape were determined. In addition other features of the bacteria plated were observed to determine how much species each plate contained. After making these conclusions, two micro-organisms from the nutrient agar and two from the nutrient agar with tetracycline plates were used to make wet mounts and gram stains. Both were observed under a microscope to characterize bacteria and observe the size. The wet mount confirmed the presence of bacteria observing its motility and the gram stain confirmed the bacteria as gram positive or negative based on the pigment. To conclude the lab experiment, two of the classified bacteria's 16S rRNA genes were amplified by use of primers and PCR to be observed the following next week.


Results: There are some differences apparent in the number of colonies between plates that contain antibiotics and those that don't. However, only 2 species of bacteria are apparent in the plates upon observation of the pigment. A white and orange pigment was observed in plates that only contained a few colonies. In dilution agar plates with tetracycline 10^-3, and 10^-9 more colonies of bacteria were counted present than the nutrient agar plate without the antibiotic. Since only 2 species were apparent within the plates, only two were unaffected by the tetracycline. Amongst all the plates, the nutrient agar plates collectively contain 241 colonies, while the nutrient with tetracycline plates contain 349 collectively. The Tetracycline 10^-9 wet mount showed that the bacteria were motile, small transparent clear dots and about 20 colonies were visible on the microscope. The nutrient 10^-9 wet mount appeared motile as well, contained one large colony moving together and about 50 colonies were visible underneath the microscope. The Tetracycline 10^-5 wet mount appeared with a green-purplish pigment and about 60 colonies were seen under the microscope. To conclude, wet mount observations the 10^-5 appeared to have a circular shape and about a few colonies present, however this wet mount showed no motile and was believed to had dried out by this observation. For gram stain observation, 10^-9 nutrient agar plate appeared to be rough and have a deep purple pigment, it was lobate and had slight irregularities and was concluded as gram positive. The 10^-5 tetracycline plate was pinkish red with an elongated shape, circular, and concluded to be gram negative. The 10^-5 nutrient plate was a bluish purple with an irregularly circular shape, and was concluded to be gram positive. To conclude gram stain observations, the 10^-9 tetracycline plate contained a dark blue pigment with an irregular shape and was concluded as gram positive.


Nutrient Agar & Tetracycline + Nutrient Agar Plate Pictures: Image:IMG_1498.jpg


Serial Dilutions Table: Image:SerialDilutionsTable.jpg

Nutrient Agar 10^-9 Wet Mount Image:wetmountpic1.jpg

Tetracycline 10^-9 Wet Mount Image:wetmountpic2.jpg

10^-9 Nutrient Agar Plate Gram Stain Image:IMG_1513.jpg

10^-9 Tetracycline Nutrient Plate Gram Stain Image:IMG_1521.jpg

10^-5 Tetracycline Plate Gram Stain Image:IMG_1526.jpg

10^-5 Nutrient Agar Gram Stain Image:IMG_1532.jpg


Discussion: Using the serial dilution plates to observe the colony morphology reflects the idea that antibiotic resistance is high on the rise. 10^-3 and 10^-9 tetracycline plates contained more bacterial colonies, which means they are resistant to the antibiotic. Overall, there were bacterial colonies amongst all the tetracycline plates than there were in the ones within the antibiotic. This indicates that this antibiotic is indeed feeding the bacteria and that it has no profound effect on the bacterial growth. Tetracycline would commonly kill bacteria or inhibit the growth of bacterial colonies that it has a mechanism of action on, hence why it is used as a variable (Bio 210 Lab Manual). Its hard to tell which kind of bacteria based on gram stain this specific antibiotic has an effect on. As in the 10^-9 gram positive plates more bacteria were found on the tetracycline plate, whereas in the 10^-5 gram positive for nutrient and gram negative for the tetracycline containing, the one with the tetracycline containing had a few more colonies of bacteria. One can suggest that from our experiment maybe tetracycline has a more significant effect on gram negative bacteria, however further experimentation would need to be carried out to confirm this. Amongst the gram stain procedures, three bacterial colony groups were positive and one was negative. This gram negative bacteria contained the only pinkish red pigment and was affected by tetracycline in terms of growth. From this, we might be able to hypothetically conclude that tetracycline has an effect on a certain bacteria causing the peptidoglycan presence within the cell wall to lessen, thus why the bacteria is gram-negative.


Lab #4: Plantae & Fungi

Introduction: Plants and Fungi are two groups among the Protists that have an immense impact and influence on the environment and ability for other life to live. Plants are photosynthetic, providing sugar and oxygen to other organisms in the environment. Fungi can serve as decomposers cleaning up the pollution within our environment, making space, and aiding plants in nutrients within their roots and soil. The diversity of plant life today is due to the adaptation of plants to land from aquatic environments. this diversity stem from the presence of vascularization, presence of specialized structures, and mechanism of reproduction (Bio 210 Lab Manual). Through the morphological observation by microscope, one can examine the characteristics of various plant and fungi life.

Materials & Methods: Prior to beginning the lab, PCR samples were observed. The ones retrieved lacked volume and substance and thus 10 microliters of 1x TAE buffer was added to each sample. Sample Tetracycline 10^-5 was loaded in the second to last space in lane 1. In this lab experiment, transect 2 was revisited to collect 500 grams worth of diverse plant life and leaf litter from various areas of our transect. Each plant life collected was paralleled according to its location within the transect. A few samples were then put under the microscope to observe and identify the vascularization and size of these plant life within the transect. Using the key provided as a model, 5 samples mechanisms of reproduction were determined, along with other characteristics that were observed. Thereafter, a fungi sample provided was observed. The inner structures and characteristics were used to justify why this sample was coined as a Fungi. To conclude procedures, a berlese funnel leaf litter sample was created through use of a ethanol/water solution and screening material ( to keep the leaf litter in tack) to observe invertebrates that reside in transect for the following week (Bio 210 Lab Manual).

Results: The plant life and leaf litter was not very diverse in our transect, however from the corners and middle of our transect we collected samples of leaves and litter. Due to the winter conditions outside, majority of the trees were bare thus there was more leaf litter available than plant life alive available to collect. Among the plant life collected, 4 plants had vascularization and one did not. In addition, all samples were classified as dicots which accounted for their mechanism of reproduction. These conclusions among the many made, shown in the pictures below were based on the key provided of common characteristics among plants that contain vascularization and that are monocot or dicot. Among the samples there was no evidence of spores apparent. There were also no flowers apparent and this was concluded based on the fact that our transect showed no sign of any flowers. The fungi we identified that was collected prior was a mushroom. We were able to conclude due to observation of its hyphae and mycelium structures. Through aid of a key for identifying fungi we came to these conclusions. In addition since fungi reproduce via spores, it makes sense why this particular fungus would be a mushroom in terms of its ability to appear in various places.

Pictures:

Plant Samples #1 - 5 in Order from Left to Right

Image:IMG_1651.jpg


Plant Sample #1 Image:IMG_1628.jpg

Plant Sample #2 Image:IMG_1631.jpg

Plant Sample #3 Image:IMG_1636.jpg Image:IMG_1638.jpg

Plant Sample #4 Image:IMG_1640.jpg Image:IMG_1642.jpg

Plant Sample #5 Image:IMG_1647.jpg Image:IMG_1648.jpg

Image:IMG_table1pic1.jpg Image:IMG_table1pic2.jpg

Fungi Mushroom: Image:IMG_1654.jpg Image:IMG_1655.jpg

Conclusion: Upon observing the plant life of transect 2, our predictions of diversity among the transect was deemed too vague and far a conclusion. According to the mechanisms of reproduction and morphological structure of the plants we collected, they appeared to be quite similar and might have been part of a similar or related lineage. Though most of these plant samples contained vascularization, each sample had slightly different specialized structure which could account for its own function and contribution ecologically. Though a variety of plant life was requested, our transect upon examining just physical structure didn't appear to contain that much of a variety of plant life. This may have also been because of the weather conditions, it being winter, imposed on the transect. We also realized that the transect was influenced my some man made influence with a pipe system controlling the flowing stream in the center of it, and stones for a pathway being placed on the outskirts of it. All in all, through microscopic observation we were able to conclude that the plants were different in terms of specialization but similar in terms of its mechanisms of reproduction.

Lab #5: Invertebrates and Vertebrates

Introduction: Animals have two type of structural features that classify organisms today, vertebrates and invertebrates. Vertebrates have believed to evolve from invertebrates, which are the simplest animal form with little to no symmetry and less muscular and motile structures. Common example of an invertebrate is a sponge, which has no symmetry and do not form tissues (Biology 210 Lab Manual). The germ layer tissues that make up animals are ectoderm, which form skin and nerves, endoderm, which form the digestive pathway, and mesoderm which form bones and muscle. However in some invertebrates like the jellyfish no mesoderm layer is present, as this organism does not need muscle movement to move. Though sponges have no symmetry there are a myriad of other invertebrates that account for having, radial symmetry and bilateral symmetry. Radial symmetry is a mirror image of more than one plane among the structure of the animal, while bilateral is one mirror image or plane among its structure. Humans account for a bilateral symmetrical structure as the left and right sides of the body is a reflection of each other generally, similar to that of many invertebrates. Invertebrates are also divided on the embryonic level (Biology 210 Lab Manual). Some are considered protostomes, where their mouths form before their anus, and others are considered deuterostomes where the anus forms before the mouth. In this lab experiment, the biodiversity of transect 2 is further explored through observing invertebrates from Berlese funnel collections. It is predicted that transect 2 might not have a wide variety of invertebrates as the the type of transect, is mostly contained of soil and a stream.

Materials & Methods: First, the Berlese Funnel was set up through a series of events. After collecting a leaf litter sample from transect 2, our funnel was made through pouring 25 ml of an equal ethanol-water solution into a conical tube and placing some screening in the bottom of the funnel. Thereafter, the leaf litter was placed in the funnel and the funnel was attached and secured to the conical tube. To hold this in place, it was attached to a ring stand and then a 40 watt lamp was placed on top of the Berlese funnel set-up to be observed for the following lab investigation. In the following lab procedure, contents of the Berlese funnel were observed via a dissecting microscope. This observation was used to classify the invertebrates that exist in transect 2.

Results:

Image:16670.jpg

Pictures:

Arthropod-Flea Image:FleaPic1.jpg Image:FleaPic2.jpg

Arthropod-Chewing or Sucking Lice Image:LicePic3.jpg

Mollusk-Termite Image:TermitePic4.jpg

Arthropod-Tick Image:TickPic5.jpg Image:TickPic6.jpg

Conclusion: In conclusion, transect 2 contained arthropods and a mollusk among the invertebrate organisms classified. There was also evidence that perhaps a spider or other insects might be within the transect that account for vertebrate organisms. All invertebrates were different in terms of some of the structural observations but similar in size, all generally small. The two samples from the funnel showed no differentiation as they contained the same phylum of organisms. Arthropods are the most common organism in the leaf litter which makes sense due to the fact that our transect is mostly soil. Due to the transect's moist and soil containing features, this is evidence to suggest that other bugs might be existing within the soil. Due to abiotic conditions of the transect, organisms like birds and bees might be absent from the transect around this time due to the lack of vegetation.

Five vertebrate organisms according to the Biological Science literature that could be found in transect 2 account for that of frogs, toads, salamanders, lizards, and birds. Due to the soil and diverse plant life, these are organisms that are predicted to best be able to adapt and thrive in transect two's conditions. For a bird you would typically find like an American Crow. The classification from phylum to species would be a chordata, the class as aves, passeriformes as the order, family classification of cordivae (crow,jay), genus as corvus, and the species for American Crows as brachyrhynchos. Another example among the bird species is an Northern Cardinal, which from phylum to species would have classifications of: Chordata, Aves, Passerformes, Cardinalidae, and the genus and species Cardinalis cardinalis. Similarly you have the toad which classifications from phylum to species are as follows: Chordata, Amphibia, Anura, Bufonidae, Bufo, and B. bufo. Another common vertebrate that could be found in transect 2 is a garden lizard whose classification from phylum to species is as follows: Chordata, Reptilia, Squamata, Agamidae, Calotes, and C. versicolor. To conclude the 5 possible vertebrate in transect 2 is the green frog which classifications from phylum to species are as follows: Chordata, Amphibia, Anura, Ranidae, Rana, and the species Arvalis. All organisms each play a role in maintaining stability and ecological function in the transect. The plants which provide oxygen and energy, sunlight which provide minerals, stream which provide water, and soil which provide a home all serve as abiotic and biotic characteristics of the transect that would benefit each species.

Food Web:

Carnivores & Secondary Consumers (Vertebrates, ex:Birds)

                  ^^

Primary Consumers & Herbivores (Invertebrates, Insects: Arthropods)

                  ^^

Plants (Plant Leaf Litter & Samples)

                  ^^

Soil & Decay Detrivores (Bacteria, Archaea, Fungi)

These organisms represent the ecological concept of community by depending and interacting with each other within their environment to survive and ultimately produce offspring. The dependence of these different species in such a small transect calls for a certain level of carrying capacity which limits only a certain amount of abundant life and organisms within that environment so that the masses can thrive and benefit. As shown by the food web above this interdependence allows everyone to survive but also creates trophic levels within an environment, which brings together different species with similar functions and the same nutritional goal. Overall, predictions proved to be accurate as a uniform species of invertebrates were classified from the Burlese funnel observations.

Personal tools