This is the sequence for Cre from the Griffitts lab in pJG125

From OpenWetWare

Jump to: navigation, search

Back to Cre-Lox

Here is the sequence for Cre in the griffitts plasmid pJG125:

CRE ORF IN 125 1032 BP

atgTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGA TGCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATC GCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTCTGTCCGTTTGCCGG TCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGA ACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGG CAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGT CGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTAT GCGGCGAATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGG CTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAA AATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGC TTATAACACCCTGTTACGTATAGCCGAAATTGCCAGGATCAGGGTTAAAG ATATCTCACGTACTGACGGTGGGAGAATGTTAATCCATATTGGCAGAACG AAAACGCTGGTTAGCACCGCAGGTGTAGAGAAGGCACTTAGCCTGGGGGT AACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGATGATC CGAATAACTACCTGTTTTGCCGGGTCAGAAAAAATGGTGTTGCCGCGCCA TCTGCCACCAGCCAGCTATCAACTCGCGCCCTGGAAGGGATTTTTGAAGC AACTCATCGATTGATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACC TGGCCTGGTCTGGACACAGTGCCCGTGTCGGAGCCGCGCGAGATATGGCC CGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCTGGTGGCTGGACCAA TGTAAATATTGTCATGAACTATATCCGTAACCTGGATAGTGAAACAGGGG CAATGGTGCGCCTGCTGGAAGATGGCGACtag

Personal tools