Template:SBB12 part sbb1225

Partname:     sbb1225
Featurename:  Tar
Genename:     tar
Source:       Escherichia coli MG1655

Should bind aspartate. See paper PMID 8393938 for location of the truncation. You want the same fragment of Tar as used in their paper. PMID 17609131 may also be a useful reference.

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.

Construction File

PCR hhe0120F/hhe0120R on  MG1655 gen.     (802 bp, pcrpdt)
Digest pcrpdt                             (Nhel/BamHI, L, pcrdig) 
Digest pBca9525-Bca1834                   (NheI/BamHI, L, vectdig)
Product is pBca9525-sbb1225      {ToxR-Tar}
----
>hhe0120F          Forward cloning of Tar gene without the start codon
ccatagctagcGGCAGTGGATCTGGTattaaccgtatccgcgtagtc
>hhe0120R        Reverse  cloning of Tar gene at truncation site  
CTGTAGGATCCttatgaaacgctctgcgccag
>pcrpdt
CCATAGCTAGCGGCAGTGGATCTGGTATTAACCGTATCCGCGTAGTCACGCTGTTGGTAATGGTGCTGGGGGTATTCGCACTGTTACAGCTTATTTCCGGCAGTCTGTTTTTTTCTTCCCTTCACCATAGCCAGAAGAGCTTTGTGGTTTCCAATCAATTACGGGAACAGCAGGGCGAGCTGACGTCAACCTGGGATTTAATGCTGCAAACGCGCATTAACCTGAGTCGTTCAGCGGTACGGATGATGATGGATTCCTCCAATCAACAAAGTAACGCCAAAGTTGAATTGCTCGATAGCGCCAGGAAAACATTGGCGCAGGCAGCGACGCATTATAAAAAATTCAAAAGCATGGCACCGTTACCTGAAATGGTCGCTACCAGTCGTAATATTGATGAAAAATATAAAAACTATTACACAGCGTTAACTGAACTGATTGATTATCTAGATTATGGCAATACTGGAGCTTATTTCGCTCAGCCAACCCAGGGAATGCAAAATGCAATGGGCGAAGCGTTTGCTCAGTACGCCCTCAGCAGTGAAAAACTGTATCGCGATATCGTCACTGACAACGCAGATGATTACCGATTTGCCCAGTGGCAACTGGCGGTTATCGCGCTGGTGGTGGTATTGATTCTGCTGGTGGCGTGGTACGGCATTCGCCGTATGTTGCTTACTCCGCTGGCAAAAATTATTGCTCACATTCGCGAAATCGCCGGTGGTAACCTGGCGAATACCCTGACCATTGACGGGCGCAGTGAAATGGGCGACCTGGCGCAGAGCGTTTCATAAGGATCCTACAG