Template:SBB12Project stdt1205

From OpenWetWare

Jump to: navigation, search

Annie Joseph

Welcome to your project page!

I've given you two parts to make.

  • Design oligos to make your part
  • Write up a proper construction file on the wiki template associated with your part
  • Enter your Features (REMEMBER: It's not a bug, it's a feature. We just don't know what it does yet), Oligos, Parts, and Plasmids into Clotho

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like, and rename the link from "Your Name Here" to your name.

Finally, you should create a notebook on the on the main class page of the wiki


Partname:     sbb1216
Featurename:  cI-N-AmilCP-B
Genename:     cI, AmilCP
Source:       Lambda phage / via the Registry

This one is a little different. You aren't putting a homodimer onto ToxR; you're building out a different homodimerization system. You're replacing ToxR with a different dimerization reporter, and then fusing it with amilCP, a very blue protein, which will facilitate future cloning. This one is the cI transcription repressor from lambda phage, which has been shown to do similar reporting of homodimerization as is reported for ToxR (see PMID 10411275). You'll need to carefully read this paper to determine how much of cI to include in your system -- you probably don't want 100% of the ORF for this part.

Your final construct should be a normal BglBricks part in plasmid pBca9525. You most likely will want to piece the part together from two pcr products using SOEing to get something like:

 EcoRI-BglII-Pcon.rbs.cI-spacer-NheI-spacer-PglpT.rbs.AmilCP!-BamHI

Note that this construct has 2 promoters and no terminator in between them. It's a little unusual design-wise, but usually works out ok. You can get the PglpT-AmilCP fragment from plasmid pBjk2741-jtk3346. The cI construct can be amplified from Media:pBca9145-jtk2768.str

In designing the junction between cI and the NheI site, you should make the spacer and frame match those of the ToxR constructs (see this illustration).

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.


Construction File

PCR ca998/osbbl333R on pBca9145-jtk2768      (641bp, A)
PCR osbbl216F/g00101 on pBjk2741-jtk3346     (950bp, B)
PCR ca998/g00101 on A+B                      (1571bp, pcrpdt)
Digest pcrpdt                                (EcoRI/BamHI, L, pcrdig)
Digest pBca9525-Bca1834                      (EcoRI/BamHI, L, vectdig)
Ligate pcrdig and vectdig, product is pBca9525-sbb1216
----
>ca998
gtatcacgaggcagaatttcag
>g00101
attaccgcctttgagtgagc
>osbbl333R
AGATCCACTGCCgctagcAGATCCgcttggcttggagcc
>osbbl216F
CTGCTAGCGGCAGTGGATCTAGTgaaagtgaaacgtgatttc
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGTTAATGCTAGCTCAGTCCTAGGGACTCTGCTAGCGGATCTAGACATAAAAACGGCAAAGTATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTGCAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATGTTCAGGCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCACAACCAAAAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCATGACCGCACCAACAGGCTCCAAGCCAAGCGGATCTGCTAGCGGCAGTGGATCTAGTGAAAGTGAAACGTGATTTCATGCGTCATTTTGAACATTTTGTAAATCTTATTTAATAATGTGTGCGGCAATTCACATTTAATTTATGAATGTTTTCTTAACATCGCGGCAACTCAAGAAACGGCAGGTTCGGATCTGACTAATTTAACGAGGAGGATTTCATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGTAAGCCCTACGAGGGGGAGCAGACGGTAAAGCTCACTGTCACCAAGGGCGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACAGTGTCAGTACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGACTATGTAAAGCAGTCATTCCCGGAGGGCTATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACCATGTCAAGTTCTCTGGTTTGAACTTTCCTCCCAATGGACCTGTCATGCAGAAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCTTTGCACGAGATGGAATGCTGCTAGGAAACAACTTTATGGCTCTGAAGTTAGAAGGAGGCGGTCACTATTTGTGTGAATTTAAAACTACTTACAAGGCAAAGAAGCCTGTGAAGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAATCACAACAAGGATTACACTTCGGTTGAGCAGTGTGAAATTTCCATTGCACGCAAACCTGTGGTCGCCTAATAAGGATCCTAACTCGCTCCTCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAAT


The construction file for sbb1216

Construction of  sbb1216 part
PCR aj1000F/aj1000R on pBca9145-jtk2768 (387 bp, A)
PCR aj2000F/aj2000R on pBjk2741-jtk3346 (868 bp, B)
PCR aj1000F/aj2000R on A+B (1231 bp, pcrpdt)
Digest pcrpdt (EcoRI/BamHI, L, pcrdig)
Digest pBca9525-Bca1839 (EcoRI/BamHI, 627+3494, plasdig)
Ligate pcrdig and plasdig, product is  pBca9525-sbb1216 (3689bp)
------------
>aj1000F
ccaaaGAATTCatgAGATCTgttaatgctagctcagtcct
>aj1000R
TCCACTGCCgctagcTCCTGACCCGCTTCCaaccgcttcatacatctcgt
>aj2000F
GGGTCAGGAgctagcGGCAGTGGATCTGGTgaaagtgaaacgtgatttca
>aj2000R
ttaGGATCCttattaggcgaccacaggtttgc
>pBca9525-sbb1216
GAATTCatgAGATCTgttaatgctagctcagtcctAGGGACTCTGCTAGCGGATCTAGACATAAAAACGGCAAAGTatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttGGAAGCGGGTCAGGAgctagcGGCAGTGGATCTGGTgaaagtgaaacgtgatttcatgcgtcattttgaacattttgtaaatcttatttaataatgtgtgcggcaattcacatttaatttatgaatgttttcttaacatcgcggcaactcaagaaacggcaggttcGGATCTGACTAATTTAACGAGGAGGATTTCatgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataaGGATCCtaaCTCGAcgtgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatCAATTCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCATCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTcctaggTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGAATTGgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg}}


Partname:     sbb1205
Featurename:  lz_RLEK
Genename:     leucine zipper variant
Source:       Synthetic, see PMID:12459719 

This part encodes a leucine zipper

We will be using a set of leucine zippers as homodimer domains. In total, we'll have 8 of them all with different Kd's for homodimerization. However, the sequences only differ at the same 4 amino acid sites. This will allow us to test whether the activation of ToxR is dependent on the Kd of the homodimer that is attached to it. These sequences are entirely synthetic, but all should encode the following peptide:

 VKELEDKNEELLS XX YH XX NEVARLKKLVGERGGC*

Where the x's are the amino acids I tell you. So, if I gave you the lz_IILK zipper to make, the peptide you should encode is: VKELEDKNEELLSIIYHLKNEVARLKKLVGERGGC*

Here is an example of what your trying to make pBca9525-sbb1230.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

PCA1 on o1,o5,o2          (pca1)
PCA2 with o1/o2 on pca1   (142 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1205dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1205dig + vectdig, product is pBca9525-sbb1205
----
>o1	
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGT
>o2	
CAGTAGGATCCTTAGCAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>o5
CAAAAACGAAGAACTGCTGAGTCGACTCTACCACGAGAAGAACGAAGTTGCTCGTCTGA
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGTCGACTCTACCACGAGAAGAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTGCTAAGGATCCTACTG


The construction file for sbb1205



Wobble aj998/aj999 (145bp, wobpdt)
Digest wobpdt (NheI/BamHI, L, wobdig)
Digest  pBca9525-Bca1839 (NheI/BamHI, 627+3494, plasdig)
Ligate wobdig + plasdig (3623bp, pBca9525-sbb1205)
-----------------------------------------------
> aj998 Forward construction of synthetic peptide sequence lz_RLEK
ccatagctagcggcagtggatctggtGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGTCTCGTCTGTACCACG
>aj999 Reverse construction of synthetic peptide sequence lz_RLEK
ctgatGGATCCTTAGCAACCACCACGTTCACCAACCAGTTTTTTCAGACGAGCAACTTCGTTTTTTTCGTGGTACAGACGAGACAGCAG

>pBca9525-sbb1205
GATCTCTCATTAATAAACTGGCAATGACCAAGACCAATGACGATTTCTTCGAAATGATGAAACGCTCATAAATTTGTCTTATGCCAAAAACGCCACGTGTTTACGTGGCGTTTTGCTTTTATATCTGTAATCTTAATGCCGCGCTGGCGATGTTAGGAAAATTCCTGGAATTTGCTGGCATGTTATGCAATTTGCATATCAAATGGTTAATTTTTGCACAGGACTGGTGGGTTTGGAACGGACTTTCCCTTCTGAATAAAGGTCTTCGTGGTTATACTTCTGCTAATAATTTTCTCTGAGAGCATGCATTGTGAATTTACTGACAGTGAGTACTGATCTCATCAGGGATCTGCCACGCACAAAACTACGGTAGCAAATGTTCGGATTAGGACACAACTCAAAAGAAATCTCGATGAGTCATATTGGTACTAAATTCATTCTTGCTGAAAAATTTACCTTCGATCCCCTAAGCAATACTCTGATTGACAAAGAAGATAGTGAAGAGATCATTCGATTAGGCAGCAACGAAAGCCGTATCCTTTGGCTGCTGGCCCAACGTCCAAACGAGGTAATTTCTCGCAATGATTTGCATGACTTTGTTTGGCGAGAGCAAGGTTTTGAAGTCGATGATTCCAGCTTAACCCAAGCCATTTCGACTCTGCGCAAAATGCTCAAAGATTCGACAAAGTCCCCACAATACGTCAAAACGGTTCCGAAGCGCGGTTACCAATTGATCGCCCGAGTGGAAACGGTTGAAGAAGAGATGGCTCGCGAAAACGAAGCTGCTCATGACATCTCTCAGCCGGAGTCCGTCAATGAATACGCAGAATCAAGCAGTGTGCCTTCATCTGCTACCGTAGTGAACACACCGCAGCCAGCCAATGTCGTGGCGAATAAATCGGCTCCAAACTTGGGGAATCGACTGTTTATTCTGATAGCGGTCTTACTTCCCCTCGCAGTATTACTGCTCACTAACCCAAGCCAATCCAGCTTTAAACCCCTAACGGGATCTgctagcggcagtggatctggtGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGTCTCGTCTGTACCACGAAAAAAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGTGAACGTGGTGGTTGCTAAGGATCCtaaCTCGAcgtgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatCAATTCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCATCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTcctaggTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGAATTGgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctgGAATTCATGA
Personal tools