Template:SBB12Project stdt1201

From OpenWetWare

Jump to: navigation, search

Robert D O'Dowd

Welcome to your project page!

I've given you two parts to make.

  • Design oligos to make your part
  • Write up a proper construction file on the wiki template associated with your part
  • Enter your Features (REMEMBER: It's not a bug, it's a feature. We just don't know what it does yet), Oligos, Parts, and Plasmids into Clotho

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like, and rename the link from "Your Name Here" to your name.

Finally, you should create a notebook on the on the main class page of the wiki


Partname:     sbb1231
Featurename:  cI-TM
Genename:     cI, other
Source:       Lambda phage / other

This one is a little different. You aren't putting a homodimer onto ToxR; you're building out a different homodimerization system. In this experiment, you are trying to reproduce some experiments based on PMID 9671551. In their study, they append different dimerizing transmembrane (TM) segments to the lambda repressor DNA binding domain fragment (cI') and see whether CI's activity is restored. In one case, they discuss making fusion proteins such as:

 Nterm-cI'-linker-TM-PhoA-Cterm

That would be a nice construct to have because you can do 2 assays with it: transcriptional repression from cI-dependent promoters, and periplasmic targetting with alkaline phosphatase.

Your design of this part depends on your reading of the paper and the availability of materials from which you could construct the things they describe. You'll probably want to discuss the design of your part with JCA after you have read and made sense of the paper. Your final construct should be a normal BglBricks part in plasmid pBca9525. You most likely will want to piece the part together from two (or more) pcr products. The cI construct can be amplified from pBca9145-jtk2768. You can get PhoA from plasmid pBjh1601CK-Bjh2128.

Construction File

PCR ca998/rdoSOECI_TM-R  on pBca9145-jtk2768	        (cifrag, 583bp)
PCR rdoSOETM_PhoA-F/g00101 on pBjh1601CK-Bjh2128	(phofrag, 1327bp)
PCR ca998/g00101 on cifrag+phofrag                      (pcrpdt_sbb1231, 1890bp)
Digest pBca9525-Bca1834				        (EcoRI/BamHI, L, vectdig)
Digest pcrpdt_sbb1231				        (EcoRI/BamHI, L, pcrdig)
Ligate pcrdig and vectdig, product is pBca9525-sbb1231
----
>rdoSOECI_TM-R   Combining CI'head and MalF TM
CCAACCAGCAGACCCAGCAGACCCAGAACAGACCATTTACGTTTAGATCCgcttacccatctctccgcatc
>rdoSOETM_PhoA-F  Combining MalF TM with PhoA
CTGCTGGGTCTGCTGGTTGGTTACCTGGTTGTTCTGATGTACGGATCTtctagaATTGATGCCCTGCCGCTGAC
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGTTAATGCTAGCTCAGTCCTAGGGACTCTGCTAGCGGATCTAGACATAAAAACGGCAAAGTATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTGCAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATGTTCAGGCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCGGATCTAAACGTAAATGGTCTGTTCTGGGTCTGCTGGGTCTGCTGGTTGGTTACCTGGTTGTTCTGATGTACGGATCTTCTAGAATTGATGCCCTGCCGCTGACCGGACAATATACCCACTATGCGCTGAATAAAAAAACCGGCAAACCAGATTACGTGACCGATTCCGCCGCCTCAGCCACCGCGTGGTCCACAGGGGTGAAAACCTACAACGGCGCGCTGGGGGTCGATATTCATGAAAAAGATCATCTGACCATTCTCGAAATGGCGAAGGCCGCAGGTCTGGCTACCGGCAACGTCTCGACCGCGGAGTTGCAGGACGCCACCCCGGCAGCGCTGATTGCCCATGTCACCTCGCGCAAATGCTATGGCCCGACGGCGACCAGCGAAAAATGTCCGACAAACGCGCTGGAAAAGGGCGGCAAAGGCTCGATTACTGAACAGCTCCTGAACGCGCGGGCGGACGTCACCCTGGGCGGCGGCGCGAAAACCTTCGCCGAGACGGCAACCGCCGGCGAGTGGCAGGGGAAAACGCTGCGTGAGCAGGCGCAGATGCGCGGCTACCAGTTAGTCGGCGATGCCGCCTCTTTAGCGGCGATCGACGAAGCGAATCAGGACAAACCGCTGCTGGGACTGTTCGCAGAGGGGAATATGCCGGTGCGCTGGGAAGGGCCGAAGGCCTCGTACCACGGCAATATTGATAAACCTGCCGTGACCTGTACGCCAAATCCGAAACGCAATGACGCGATTCCCACGCTGGCGCAGATGACCGACAAAGCCATCGAACTGTTGAGCAAAAATGAGCGGGGCTTCTTTTTACAGGTGGAAGGCGCGTCTATCGATAAGCAGGATCACGCCGCGAACCCGTGCGGACAGATTGGCGAGACGGTGGATCTTGATGAAGCCGTACAGAGGGCGCTGGCCTTTGCGAAGAAAGACGGCAATACGCTGGTGATCGTTACCGCCGATCATGCTCATGCCAGCCAGATCGTGGCGCCCGAAACGAAAGCGCCGGGGCTGACGCAGGCGCTGAACACCAAAGATGGCGCGGTGATGGTCATCAGCTACGGCAACTCGGAAGAAGATTCCCAGGAGCATACCGGCAGCCAGCTGCGCATCGCCGCTTACGGGCCGCATGCGGCGAACGTGGTCGGGCTGACCGATCAAACCGATCTGTTCTACACCATGAAAGCGGCGCTGGGCCTGAAGTAATGGATCTAAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTTAGGATCCTAACTCGACGTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAAT

Partname:     sbb1214
Featurename:  lz_AAAA-3
Genename:     leucine zipper variant
Source:       Synthetic, see PMID:12459719 

This part encodes a leucine zipper

We will be using a set of leucine zippers as homodimer domains. In total, we'll have 8 of them all with different Kd's for homodimerization. However, the sequences only differ at the same 4 amino acid sites. This will allow us to test whether the activation of ToxR is dependent on the Kd of the homodimer that is attached to it. These sequences are entirely synthetic, but all should encode the following peptide:

 VKELEDKNEELLS XX YH XX NEVARLKKLVGERGGC*

Where the x's are the amino acids I tell you. So, if I gave you the lz_IILK zipper to make, the peptide you should encode is: VKELEDKNEELLSIIYHLKNEVARLKKLVGERGGC*

Here is an example of what your trying to make pBca9525-sbb1230.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

PCA1 on o16,o17,o12       (pca1)
PCA2 with o16/o12 on pca1 (139 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1214dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1214dig + vectdig, product is pBca9525-sbb1214
----
>o16	
CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAGCAGAAGAAGCGCTGAGT
>o17
CAAAGCAGAAGAAGCGCTGAGTATCATCTACCACCTGAAAAACGAAGTTGCTCGTCTGA
>o12
CAGTAGGATCCTTAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAGCAGAAGAAGCGCTGAGTATCATCTACCACCTGAAAAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTAAGGATCCTACTG
Personal tools