Template:SBB10 ConstructionFiles XiaoL sbb04

From OpenWetWare

Jump to: navigation, search

Construction file for piggyBac transposase (check for errors)

2) construction file for piggyBac transposase (sbb04)
PCR with piggyBac01 and piggyBac03 on pBca9523-Bca1519 (928bp, gp, A)
PCR with piggyBac02 and piggyBac04 on pBca9523-Bca1553 (925bp, gp, B)
-----------------------------------------------------------------
PCR with piggyBac01 and piggyBac04 on A+B	(1813bp, EcoR1/BamH1)
Digest pBjk2741-Bca1144			(EcoR1/BamH1, 2170bp + 910bp,L)
Product is  pBjk2741-sbb04   
-----------------------------------------------------------------
piggyBac01 Forward PCR of part 1 of piggyBac ccatagaattcatgAGATCTGGTTGCTCTCTGGACGACGAAC
piggyBac02 Forward SOEing part of piggyBac   ACGGTATCAAAATCCTGATGatgtgcgactctggtaccaa
piggyBac03 Reverse SOEing part of piggyBac   ttggtaccagagtcgcacatCATCAGGATTTTGATACCGT
piggyBac04 Reverse PCR of part 2 of piggyBac gctagGGATCCttaGAAGCAAGACTGGCACATG

JCA Notes

  • Correct
  • Need to put this part into Clotho
  • Is {<piggyBac!}
  • I modified it to correct for template errors:


Construction file for piggyBac transposase (sbb04)

PCR with piggyBac01/CA1530 on Bca1519 3-2          (335bp, gp=A)
PCR CA1527/piggyBac03 on Bca1519 3-1               (721bp, gp=B)
PCR with piggyBac02/piggyBac04 on Bca1553 4-6      (925bp, gp=C)
-----------------------------------------------------------------
PCR with piggyBac01 and piggyBac04 on A+B+C	(1813bp, EcoRI/BamHI)
Digest pBjk2741-Bca1144			(EcoRI/BamHI, 2170bp + 910bp,L)
Product is  pBjk2741-sbb04   {<piggyBac!}
-----------------------------------------------------------------
piggyBac01 Forward PCR of part 1 of piggyBac 
ccatagaattcatgAGATCTGGTTGCTCTCTGGACGACGAAC
CA1527	TGGACGAACAGAACGTTATCGAACAGCCGGGTTCTTCTCTGGCTTCT
PCA assembly of piggiebacfiveprime (Bca1519)
CA1530	ACGACGGGTAGATTTAGAGGTAGACCAGCAGTGTTTGTTTTTACCAC
PCA assembly of piggiebacfiveprime (Bca1519)
piggyBac02 Forward SOEing part of piggyBac   
ACGGTATCAAAATCCTGATGatgtgcgactctggtaccaa
piggyBac03 Reverse SOEing part of piggyBac   
ttggtaccagagtcgcacatCATCAGGATTTTGATACCGT
piggyBac04 Reverse PCR of part 2 of piggyBac 
gctagGGATCCttaGAAGCAAGACTGGCACATG
Personal tools