Template:SBB10 ConstructionFiles XiaoL sbb03

From OpenWetWare

Jump to: navigation, search

Construction file for tos (check for errors)

1) sbb03:  tos site of N15

Pool tos01 through tos20, assemble by PCA(550bp,gp)
PCR tos01/tos20 on PCA reaction	(550bp,EcoR1/BamH1,)
Sub into pBca9145-jtk2625    (EcoRI/BamHI, 2057+929bp, L)
Product is pBca9145-sbb03

------------
tos01	PCA assembly of tos  CCATAGAATTCATGAGATCTTCTAAGCGCAACGGTATTACTTACGT	
tos02	PCA assembly of tos  ATTTAAAATCATTAAGTTAGGTTTTAAATATACCAACGTAAGTAATACCGTTGC	
tos03	PCA assembly of tos  TTAAAACCTAACTTAATGATTTTAAATGATAATAAATCATACCAATTGC	
tos04	PCA assembly of tos  CAGCATGTTCGCTTAACTTTTGATAGCAATTGGTATGATTTATTATC	
tos05	PCA assembly of tos  AAAGTTAAGCGAACATGCTGATTTTCACGCTGTTTATACACTTTGAG	
tos06	PCA assembly of tos  ATATAGAGACGGAAGAGATAGAGATGCCTCAAAGTGTATAAACAGCG	
tos07	PCA assembly of tos  TATCTCTTCCGTCTCTATATTGAAACACAATCAAAGAACATCAATCC	
tos08	PCA assembly of tos  TTCTTAGATAGTGGGGGATGTCACATGGATTGATGTTCTTTGATTG	
tos09	PCA assembly of tos  ATCCCCCACTATCTAAGAACACCATAACAGAACACAACATAGGAATG	
tos10	PCA assembly of tos  TGTTCCGAATTATTGATACATTAATGTTGCATTCCTATGTTGTGTTCTG	
tos11	PCA assembly of tos  AATGTATCAATAATTCGGAACATATGCACTATATCATATCTCAATTACGG	
tos12	PCA assembly of tos  ATGGGCAATTGTGTGCTGATATGTTCCGTAATTGAGATATGATATAG	
tos13	PCA assembly of tos  TCAGCACACAATTGCCCATTATACGCGCGTATAATGGACTATTGTGTG	
tos14	PCA assembly of tos  GTTCTGCGCTTATGTTCTCCTTATCAGCACACAATAGTCCATTATAC	
tos15	PCA assembly of tos  GAGAACATAAGCGCAGAACAATATGTATCTATTCCGGTGTTGTGTTC	
tos16	PCA assembly of tos  TATAAGAGAACATAATAGCAGAATAACAAAGGAACACAACACCGGAATAG	
tos17	PCA assembly of tos  TCTGCTATTATGTTCTCTTATAGTGTGACGAAAGCAGCATAATTAATC	
tos18	PCA assembly of tos  ATATCGTAACACAATCAAAGAACAAGTGACGATTAATTATGCTGCTTTCG	
tos19	PCA assembly of tos  TTCTTTGATTGTGTTACGATATCCAGAGACTTAGAAACGGGGGAAGG	
tos20	PCA assembly of tos  CATAGGGATCCTTCCCCCGTTTCTAAGT

JCA Notes

  • correct
Personal tools