Template:SBB10 ConstructionFiles JoannaC sbb18

From OpenWetWare

Jump to: navigation, search
Construction of Zinc Finger Domain (zf-) (sbb18)

Pool jc01 through jc08 and jc17 through jc24, assemble by PCA
PCR jc01/jc08 on PCA reaction	(424 bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb18       {<zf->}

------------

jc01     PCA Assembly of sbb17 and sbb18     AGTTCGAATTCATGAGATCTGCACCTAAGAAGAAACGCAAAGTGGGTATCC
jc02     PCA Assembly of sbb17 and sbb18     GCCATTGCTGCTGGTACTCCATGGATACCCACTTTGCGTTTCTTCTT
jc03     PCA Assembly of sbb17 and sbb18     TGGAGTACCAGCAGCAATGGCCGAACGTCCATTCCAGTGTCGTATTTGCA
jc04     PCA Assembly of sbb17 and sbb18     TATCAGAGCGGGAGAAATTTCGCATGCAAATACGACACTGGAATGGAC
jc05     PCA Assembly of sbb17 and sbb18     GCGAAAAGCCGTTCGCTTGCGACATTTGTGGACGTAAGTTTGCC
jc06     PCA Assembly of sbb17 and sbb18     TCCGCATGCAGATCCGGCATTGGAAAGGTTTTTGACTACCAGTGT
jc07     PCA Assembly of sbb17 and sbb18     TTCGCACTCACACAGGAGAAAAGCCTTTCGCGTGTGATATCTGCGGAC
jc08     PCA Assembly of sbb17 and sbb18     GTTCAGGATCCACGGAGGTGAATTTTTGTGT
jc17     PCA Assembly of sbb18               CGAAATTTCTCCCGCTCTGATAACCTGTCTGTTCACATCCGAACGCAC
jc18     PCA Assembly of sbb18               GCAAGCGAACGGCTTTTCGCCAGTGTGCGTTCGGATGTGAACAGAC
jc19     PCA Assembly of sbb18               ATCTTCGTATGGTTGATCCGGTGAGCGTTACGGGCAAACTTACGTCCACAAATG
jc20     PCA Assembly of sbb18               TCACCGGATCAACCATACGAAGATCCACACTGGTAGTCAAAAACCTTTCCA
jc21     PCA Assembly of sbb18               TGCCGGATCTGCATGCGGAATTTTAGCCGTAGTGACACCCTCAGC
jc22     PCA Assembly of sbb18               GCTTTTCTCCTGTGTGAGTGCGAATATGTTCGCTGAGGGTGTCACTACGG
jc23     PCA Assembly of sbb18               CGGGTTGATCGAGCTGCGAACTTTCGTCCGCAGATATCACACGCGA
jc24     PCA Assembly of sbb18               TCGCAGCTCGATCAACCCGTACCAACCACACAAAAATTCACCTCCGTGGATC

JCA Notes

  • Correct
Personal tools