Template:SBB10 ConstructionFiles JoannaC sbb17

From OpenWetWare

Jump to: navigation, search
Construction of Zinc Finger Domain (zf+) (sbb17)

Pool jc01 through jc16, assemble by PCA
PCR jc01/jc08 on PCA reaction	(424 bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb17       {<zf+>}

------------

jc01     PCA Assembly of sbb17 and sbb18     AGTTCGAATTCATGAGATCTGCACCTAAGAAGAAACGCAAAGTGGGTATCC
jc02     PCA Assembly of sbb17 and sbb18     GCCATTGCTGCTGGTACTCCATGGATACCCACTTTGCGTTTCTTCTT
jc03     PCA Assembly of sbb17 and sbb18     TGGAGTACCAGCAGCAATGGCCGAACGTCCATTCCAGTGTCGTATTTGCA
jc04     PCA Assembly of sbb17 and sbb18     TATCAGAGCGGGAGAAATTTCGCATGCAAATACGACACTGGAATGGAC
jc05     PCA Assembly of sbb17 and sbb18     GCGAAAAGCCGTTCGCTTGCGACATTTGTGGACGTAAGTTTGCC
jc06     PCA Assembly of sbb17 and sbb18     TCCGCATGCAGATCCGGCATTGGAAAGGTTTTTGACTACCAGTGT
jc07     PCA Assembly of sbb17 and sbb18     TTCGCACTCACACAGGAGAAAAGCCTTTCGCGTGTGATATCTGCGGAC
jc08     PCA Assembly of sbb17 and sbb18     GTTCAGGATCCACGGAGGTGAATTTTTGTGT
jc09     PCA Assembly of sbb17               CGAAATTTCTCCCGCTCTGATACTCTGTCTGAACACATCCGAACGCAC
jc10     PCA Assembly of sbb17               GCAAGCGAACGGCTTTTCGCCAGTGTGCGTTCGGATGTGTTCAGAC
jc11     PCA Assembly of sbb17               GATCTTCGTATGAGTAGTCCGTGTACTTCGGGCGGCAAACTTACGTCCACAAATG
jc12     PCA Assembly of sbb17               TACACGGACTACTCATACGAAGATCCACACTGGTAGTCAAAAACCTTTCCA
jc13     PCA Assembly of sbb17               TGCCGGATCTGCATGCGGAATTTTAGCCGTAGTGACTCGCTCAGC
jc14     PCA Assembly of sbb17               GCTTTTCTCCTGTGTGAGTGCGAATATGCTTGCTGAGCGAGTCACTACGG
jc15     PCA Assembly of sbb17               CCTTGAGATTTGATCGCTGTGCGAACTTTCGTCCGCAGATATCACACGCGA
jc16     PCA Assembly of sbb17               TCGCACAGCGATCAAATCTCAAGGTGCACACAAAAATTCACCTCCGTGGATC

JCA Notes

  • Correct
Personal tools