Template:SBB10 ConstructionFiles JimH sbb13

From OpenWetWare

Jump to: navigation, search
2) sbb13: PhiC31 Integrase

PCR OJIMH011/OJIMH012 on pBca9523-Bca1623	(949 bp, gp = A)
PCR OJIMH013/OJIMH014 on pBca9523-Bca1659	(938 bp, gp = B)
-------------
PCR PJIMH011/OJIMH014 on A+B	(1843 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb13	{<phiC31>}
-------------
OJIMH011	Forward PCR of Part 1 of PhiC31	ccataGAATTCatgAGATCTGACACGTACGCGGGTGCTTA
OJIMH012	SOEing of Part 1 (R) of PhiC31	AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccg
OJIMH013	SOEing of Part 2 (F) of PhiC31	cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTT
OJIMH014	Reverse PCR of Part 2 of PhiC31	atcagGGATCCCGCCGCTACGTCTTCCGT

JCA Notes

  • Oligos 12 and 13 are switched
  • Otherwise correct
sbb13: PhiC31 Integrase

PCR OJIMH011/OJIMH013 on Bca1623 6-9            (949bp, gp=A)
PCR OJIMH012/CA1674 on Bca1559 7-7              (514bp, gp=B)
PCR CA1675/OJIMH014 on Bca1559 7-1	        (444bp, gp = C)
-------------
PCR PJIMH011/OJIMH014 on A+B+C	(1843 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb13	{<phiC31>}
-------------
OJIMH011	Forward PCR of Part 1 of PhiC31	
ccataGAATTCatgAGATCTGACACGTACGCGGGTGCTTA
OJIMH012	SOEing of Part 1 (R) of PhiC31	
AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccg
OJIMH013	SOEing of Part 2 (F) of PhiC31	
cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTT
CA1674	GGGCGTCGGCGCGCTCCGCAACAAGGTTCGCCCGTTCGCCGCTCTTCTCAG	
PCA assembly of phiCthreeprime (Bca1659)
CA1675	TGCGGAGCGCGCCGACGCCCTGAACGCCCTTGAAGAGCTGTACGAAGACCG	
PCA assembly of phiCthreeprime (Bca1659)
OJIMH014	Reverse PCR of Part 2 of PhiC31	
atcagGGATCCCGCCGCTACGTCTTCCGT
Personal tools