Template:SBB10 ConstructionFiles JimH sbb11

From OpenWetWare

Jump to: navigation, search
1) sbb11: sleeping beauty 5'TR

Pool OJIMH001 through OJIMH010, assemble by PCA
PCR OJIMH001/OJIMH010 on PCA reaction	(257 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb11

------------

OJIMH001	PCA assembly of sbb11	CCATAGAATTCATGAGATCTAGTTGAAGTCGGAAGTTTACATACACTTAAG
OJIMH002	PCA assembly of sbb11	GAAAAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTC
OJIMH003	PCA assembly of sbb11	AAGTTGGAGTCATTAAAACTCGTTTTTCAACTACACCACAAATTTCTTGTTAAC
OJIMH004	PCA assembly of sbb11	CTGACTTGCCAAAACTATTGTTTGTTAACAAGAAATTTGTGGTGTAGTTGAAA
OJIMH005	PCA assembly of sbb11	TTAACAAACAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGC
OJIMH006	PCA assembly of sbb11	ACAATTGTTGGAAAAATGACTTGTGTCATGCACAAAGTAGATGTCCTAACTG
OJIMH007	PCA assembly of sbb11	GACACAAGTCATTTTTCCAACAATTGTTTACAGACAGATTATTTCACTTATAATTC
OJIMH008	PCA assembly of sbb11	CCACTGGAATTGTGATACAGTGAATTATAAGTGAAATAATCTGTCTGTAAAC
OJIMH009	PCA assembly of sbb11	TAATTCACTGTATCACAATTCCAGTGGGTCAGAAGTTTACATACACTAAG
OJIMH010	PCA assembly of sbb11	CTGATGGATCCTTAGTGTATGTAAACTTCTGACCC

JCA Notes

  • Correct
Personal tools