Template:SBB10 ConstructionFiles JeniL sbb07

From OpenWetWare

Jump to: navigation, search
 
 Construction of Tn5 transposase basic part sbb07 {<tn5>}
 PCR tn5001/tn5003 on pRL27 (438 bp, gp = A)
 PCR tn5004/tn5002 on pRL27 (1069 bp, gp = B)
 ---------------------------------------------------
 PCR tn5001/tn5002 on A+B           (1462 bp, EcoRI/BamHI)
 Digest pBjk2741-Bca1144            (EcoRI/BamHI, 2170+910, L)
 Product is pBjk2741-tn5  
 ---------------------------------------------------
 tn5001   Forward EcoRI and BglII for tn5	
CCATAgaattcATGagatctATGATAACTTCTGCTCTTCATCGTGC
 tn5004   (F)Removing the Xho1 site in tn5   	     
GGGTTCACTCCGTTCTCTTGCTCGAAG
 tn5003   (R)Removing the Xho1 site in tn5   	     
CGGTGCGGAATGTGGTGGCTTCGAG
 tn5002   Reverse BamHI and BglII removal for tn5     
CTGATggatccTCGGATCTTGATCCCCTGCGCC

JCA Notes

  • Internal oligos aren't working, replacing them. The oligo needs to surround the internal site, not terminate on it. The polymerase needs min 6bp exact homology on 3' end.
  • Should remove start codon for {<part>} flavor
  • Stop codon is removed, but an extra arg was added in the process
Construction of Tn5 transposase basic part sbb07 {<tn5>}
 PCR tn5001/tn5003 on pRL27 (430 bp, gp = A)
 PCR tn5002/tn5004 on pRL27 (1056 bp, gp = B)
 ---------------------------------------------------
 PCR tn5001/tn5004 on A+B           (1456 bp, EcoRI/BamHI)
 Digest pBjk2741-Bca1144            (EcoRI/BamHI, 2170+910, L)
 Product is pBjk2741-tn5  
 ---------------------------------------------------
tn5001   Forward EcoRI and BglII for tn5	
CCATAgaattcATGagatctATAACTTCTGCTCTTCATCGTG
tn5002   (F)Removing the Xho1 site in tn5   	     
CGTTCTCTTGCTaGAGGCCACCACATTCCG
tn5003   (R)Removing the Xho1 site in tn5   	     
CGGAATGTGGTGGCCTCtAGCAAGAGAACG
tn5004   Reverse BamHI and BglII removal for tn5     
CTGATggatccGATCTTGATCCCCTGCGCC

Part: gatctATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTCGGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGTAGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGGCTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGATAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTaGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGATGACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGGTCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGAGTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAACGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGGAGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTATACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATGGTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCG
Personal tools