Template:SBB10 ConstructionFiles DanielS sbb10

From OpenWetWare

Jump to: navigation, search
PCR DS001 and DS002 on pBca9523-Bca1587  (1051 bp, EcoRI/BamHI)
Sub into pBjk2741            (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sb10         {<SB100x!}
----------------------------
DS001   Forward oligo for cloning of <SB100x!  
CCATAgaattcTCCagatctGGTAAATCTAAAGAAATCTCTCAGGAC
DS002   Reverse oligo for cloning of <SB100x!
ctgatGGATCCttaGTATTTGGTAGCGTTACCTT

JCA Notes

  • Prefix region should be atg, not TCC
  • Otherwise correct
  • Need to put part on Clotho
  • Changed to SOEing due to template errors
Construction of sbb10
PCR DS001/CA1600 on Bca1587 5-1        (420bp, gp=A)
PCR CA1597/DS002 on Bca1587 5-6        (767bp, gp=B)
----------------------------
PCR DS001 and DS002 on A+B   (1051 bp, EcoRI/BamHI)
Sub into pBjk2741            (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sb10         {<SB100x!}
----------------------------
DS001   Forward oligo for cloning of <SB100x!  
CCATAgaattcATGagatctGGTAAATCTAAAGAAATCTCTCAGGAC
CA1600	CGAAACGCAGACGAGCTTTTTTGTGACGGTTCTGGAGCAGCGGTTTTTT
PCA assembly of sleepingBeauty (Bca1587)
CA1597	ATGCTGGAAGAAACCGGTACCAAAGTTTCTATCTCTACCGTTAAACGTG
PCA assembly of sleepingBeauty (Bca1587)
DS002   Reverse oligo for cloning of <SB100x!
ctgatGGATCCttaGTATTTGGTAGCGTTACCTT

Part: gatctGGTAAATCTAAAGAAATCTCTCAGGACCTGCGTAAACGTATCGTTGACCTGCACAAATCTGGTTCTTCTCTGGGTGCTATCTCTAAACGTCTGGCTGTTCCGCGTTCTTCTGTTCAGACCATCGTTCGTAAATACAAACACCACGGTACCACCCAGCCGTCTTACCGTTCTGGTCGTCGTCGTGTTCTGTCTCCGCGTGACGAACGTACCCTGGTTCGTAAAGTTCAGATCAACCCGCGTACCACCGCTAAAGACCTGGTTAAAATGCTGGAAGAAACCGGTACCAAAGTTTCTATCTCTACCGTTAAACGTGTTCTGTACCGTCACAACCTGAAAGGTCACTCTGCTCGTAAAAAACCGCTGCTCCAGAACCGTCACAAAAAAGCTCGTCTGCGTTTCGCTACCGCTCACGGTGACAAAGACCGTACCTTCTGGCGTAACGTTCTGTGGTCTGACGAAACCAAAATCGAACTGTTCGGTCACAACGACCACCGTTACGTTTGGCGTAAAAAAGGTGAAGCTTGCAAACCGAAAAACACCATCCCGACCGTTAAACACGGTGGTGGTTCTATCATGCTGTGGGGTTGCTTCGCTGCTGGTGGTACCGGTGCTCTGCACAAAATCGACGGTATCATGGACGCTGTTCAGTACGTTGACATCCTGAAACAGCACCTGAAAACCTCTGTTCGTAAACTGAAACTGGGTCGTAAATGGGTTTTCCAGCACGACAACGACCCGAAACACACCTCTAAAGTTGTTGCTAAATGGCTGAAAGACAACAAAGTTAAAGTTCTGGAATGGCCGTCTCAGTCTCCGGACCTGAACCCGATCGAAAACCTGTGGGCTGAACTGAAAAAACGTGTTCGTGCTCGTCGTCCGACCAACCTGACCCAGCTGCACCAGCTGTGCCAGGAAGAATGGGCTAAAATCCACCCGACCTACTGCGAAAAACTGGTTGAAGGTTACCCGAAACGTCTGACCCAGGTTAAACAGTTCAAAGGTAACGCTACCAAATACTAAG
Personal tools