Template:SBB10 ConstructionFiles Chel sbb06

From OpenWetWare

Jump to: navigation, search
sbb06: piggieBac 3'TR

Pool MNF001 through MNF008, assemble by PCA 	
PCR MNF01/MNF10 on PCA reaction		(267 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb06 {<piggieBac-3'TR>}
-------------
MNF01	PCA Assembly of sbb06	CCAGTGAATTCGTCCAGATCTTTTGTTACTTTATAGAAGAAATT
MNF02	PCA Assembly of sbb06	TTATTAAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAA
MNF03	PCA Assembly of sbb06	TTTTGTTTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTG
MNF04	PCA Assembly of sbb06	CACTTACATACTAATAATAAATTCAACAAACAATTTATTTATGTT
MNF05	PCA Assembly of sbb06	TATTATTAGTATGTAAGTGTAAATATAATAAAACTTAATATCTAT
MNF06	PCA Assembly of sbb06	ATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGTTTTATT
MNF07	PCA Assembly of sbb06	AATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCAA
MNF08	PCA Assembly of sbb06	TACGTTAAAGATAATCATGCGTAAAATTGACGCATGTGTTTTATC
MNF09	PCA Assembly of sbb06	CATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGG
MNF10	PCA Assembly of sbb06	GCAGTGGATCCTTAACCCTAGAAAGATAATCATAT

JCA Notes

  • Correct except for prefix sequence should be atg
sbb06: piggieBac 3'TR

Pool MNF001 through MNF008, assemble by PCA 	
PCR MNF01/MNF10 on PCA reaction		(267 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb06 {<piggieBac-3'TR>}
-------------
MNF01	PCA Assembly of sbb06	CCAGTGAATTCatgAGATCTTTTGTTACTTTATAGAAGAAATT
MNF02	PCA Assembly of sbb06	TTATTAAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAA
MNF03	PCA Assembly of sbb06	TTTTGTTTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTG
MNF04	PCA Assembly of sbb06	CACTTACATACTAATAATAAATTCAACAAACAATTTATTTATGTT
MNF05	PCA Assembly of sbb06	TATTATTAGTATGTAAGTGTAAATATAATAAAACTTAATATCTAT
MNF06	PCA Assembly of sbb06	ATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGTTTTATT
MNF07	PCA Assembly of sbb06	AATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCAA
MNF08	PCA Assembly of sbb06	TACGTTAAAGATAATCATGCGTAAAATTGACGCATGTGTTTTATC
MNF09	PCA Assembly of sbb06	CATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGG
MNF10	PCA Assembly of sbb06	GCAGTGGATCCTTAACCCTAGAAAGATAATCATAT
Personal tools