Template:SBB10 ConstructionFiles BenB sbb01

From OpenWetWare

Jump to: navigation, search
Construction of sbb01: N15 Protelomerase

PCR BDBn15001F/BDBn15001R on Bca1455		(942 bp, gp=A)
PCR BDBn15002F/BDBn15002R on Bca1485		(1020 bp, gp=B)
--------------------------------------------------------------
PCR BDBn15001F/BDBn15002R on A+B		(1924 bp, EcoR1/BamH1)
Sub in pBjk2741-Bca1144				(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb01	{rbs.part!}

BDBn15001F	Forward retrieval, RBS introduction and BioBricking on Bca1455
CCATAgaattcATGagatctTCAATCTCGGAGGAACGGTAAGGAAGGAAAACatgAGCAAGGTAAAAATCGGTGAG
BDBn15001R	Reverse retrieval and SOE-site introduciton on Bca1455
CGCTTTTATCTTCACTGCGTTTTTTAGCTTGCCCTGAG
BDBn15002F	Forward retrieval and SOE-site introduciton on Bca1485
CTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCG
BDBn15002R	Reverse retrieval and BioBricking on Bca1485
CTGATggatccGCTGTAGTACGTTTCCCATGCGG


JCA Notes

  • got 974 for first pcr
  • No stop codon on BDBn15002R
  • Otherwise correct
  • replaced first oligo with shorter, it's pressing your luck to use an oligo that long for soeing
  • May need to alter this one based on PCR results
Construction of sbb01: N15 Protelomerase

PCR BDBn15001F/CA1472 on Bca1455 1-3          (595bp, gp=A)
PCR ca1461/BDBn15001R on Bca1455 1-1          (762bp, gp=B)
PCR BDBn15002F/BDBn15002R on Bca1485 2-1      (1023 bp, gp=C)
--------------------------------------------------------------
PCR BDBn15001F/BDBn15002R on A+B+C		(1950 bp, EcoR1/BamH1)
Sub in pBjk2741-Bca1144				(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb01	{rbs.part!}

BDBn15001F	Forward retrieval, RBS introduction and BioBricking on Bca1455
CCATAgaattcATGagatctGAGGAACGGTAAGGAAGGAAAACatgAGCAAGGTAAAAATCGG
CA1461	GGAAAGGATTGCAGAAAAGAATAACCGCGAATACTTTTAACGCCTATATGA
PCA assembly of protelomerasefiveprime (Bca1455)
CA1472	TTGTTGGAATAACTTATAAAGATAGTCACGGCGCTCCTTCCAATCATCACT
PCA assembly of protelomerasefiveprime (Bca1455)
BDBn15001R	Reverse retrieval and SOE-site introduciton on Bca1455
CGCTTTTATCTTCACTGCGTTTTTTAGCTTGCCCTGAG
BDBn15002F	Forward retrieval and SOE-site introduciton on Bca1485
CTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCG
BDBn15002R	Reverse retrieval and BioBricking on Bca1485
CTGATggatccttaGCTGTAGTACGTTTCCCATGCGG

part:  gatctGAGGAACGGTAAGGAAGGAAAACatgAGCAAGGTAAAAATCGGTGAGTTGATCAACACGCTTGTGAATGAGGTAGAGGCCATTGATGCCTCAGACCGCCCACAAGGCGACAAAACGAAGAGAATTAAAGCCGCAGCCGCACGGTATAAGAACGCGTTATTTAATGATAAAAGAAAGTTCCGTGGGAAAGGATTGCAGAAAAGAATAACCGCGAATACTTTTAACGCCTATATGAGCAGGGCAAGAAAGCGGTTTGATGATAAATTACATCATAGCTTTGATAAAAATATTAATAAATTATCGGAAAAGTATCCTCTTTACAGCGAAGAATTATCTTCATGGCTTTCTATGCCTACGGCTAATATTCGCCAGCACATGTCATCGTTACAATCTAAATTGAAAGAAATAATGCCGCTTGCCGAAGAGTTATCAAATGTAAGAATAGGCTCTAAAGGCAGTGATGCAAAAATAGCAAGACTAATAAAAAAATATCCAGATTGGAGTTTTGCTCTTAGTGATTTAAACAGTGATGATTGGAAGGAGCGCCGTGACTATCTTTATAAGTTATTCCAACAAGGCTCTGCGTTGTTAGAAGAACTACACCAGCTCAAGGTCAACCATGAGGTTCTGTACCATCTCCAGCTAAGCCCTGCGGAGCGTACATCTATACAGCAACGATGGGCCGATGTTCTGCGCGAGAAGAAGCGTAATGTTGTGGTTATTGACTACCCAACATACATGCAGTCTATCTATGATATTTTGAATAATCCTGCGACTTTATTTAGTTTAAACACTCGTTCTGGAATGGCACCTTTGGCCTTTGCTCTGGCTGCGGTATCAGGGCGAAGAATGATTGAGATAATGTTTCAGGGTGAATTTGCCGTTTCAGGAAAGTATACGGTTAATTTCTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCGTAACCAGAACGATTTATACTTTATGCGAAGCAAAATTATTCGTTGAATTATTAACAGAATTGCGTTCTTGCTCTGCTGCATCTGATTTCGATGAGGTTGTTAAAGGATATGGAAAGGATGATACAAGGTCTGAGAACGGCAGGATAAATGCTATTTTAGCAAAAGCATTTAACCCTTGGGTTAAATCATTTTTCGGCGATGACCGTCGTGTTTATAAAGATAGCCGCGCTATTTACGCTCGCATCGCTTATGAGATGTTCTTCCGCGTCGATCCACGGTGGAAAAACGTCGACGAGGATGTGTTCTTCATGGAGATTCTCGGACACGACGATGAGAACACCCAGCTGCACTATAAGCAGTTCAAGCTGGCCAACTTTTCCAGAACCTGGCGACCGGAAGTTGGGGATGAAAACACCAGGCTGGTGGCTCTCCAGAAACTGGACGATGAAATGCCAGGCTTTGCCAGAGGTGACGCTGGCGTCCGTCTCCATGAAACCGTTAAGCAGCTGGTGGAGCAGGACCCATCAGCAAAAATAACCAACAGCACTCTCCGGGCCTTTAAATTTAGCCCGACGATGATTAGCCGGTACCTGGAGTTTGCCGCTGATGCATTGGGGCAGTTCGTTGGCGAGAACGGGCAGTGGCAGCTCAAGATAGAGACACCTGCAATCGTCCTGCCTGATGAAGAATCCGTTGAGACCATCGACGAACCGGATGATGAGTCCCAAGACGACGAGCTGGATGAAGATGAAATTGAGCTCGACGAGGGTGGCGGCGATGAACCAACCGAAGAGGAAGGGCCAGAAGAACATCAGCCAACTGCTCTAAAACCCGTCTTCAAGCCTGCAAAAAATAACGGGGACGGAACGTACAAGATAGAGTTTGAATACGATGGAAAGCATTATGCCTGGTCCGGCCCCGCCGATAGCCCTATGGCCGCAATGCGATCCGCATGGGAAACGTACTACAGCTAAG
Personal tools