Template:SBB10Project-15924

From OpenWetWare

Jump to: navigation, search

Wei-Chun Hsu

Welcome to your project page!

For each part listed, you should:

  • Design oligos to make your part
  • Write up proper construction files and put it on the Construction Files page
  • Put your oligos on the Oligo Log page
  • Put your parts into Clotho

You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.

Several references have been provided to give you some background on the biology of your part.

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.

Finally, you should create a notebook on the main page of the wiki

sbb11: sleeping beauty 5'TR

 Source:  synthetic
 Target Sequence:  agttgaagtcggaagtttacatacacttaagttggagtcattaaaactcgtttttcaactacaccacaaatttcttgttaacaaacaatagttttggcaagtcagttaggacatctactttgtgcatgacacaagtcatttttccaacaattgtttacagacagattatttcacttataattcactgtatcacaattccagtgggtcagaagtttacatacactaa
 Vector:  pBjk2741
 Short description: sleeping beauty 5'TR  
 Family:  Terminal Repeat

This part encodes a DNA cis element

DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.

This part is associated with sleeping beauty transposon devices

Sleeping Beauty transposase is a popular enzyme that generates protein-DNA complexes called transposomes from DNAs flanked by "terminal repeats". These terminal repeats, or TR's, are specific cis elements. The transposomes are highly reactive and insert the DNA contained within them randomly into other DNAs (such as a genome).

You should read the following papers
References: DOI 10.1007/s10989-007-9114-z, PMID 19412179

This part requires Gene Synthesis

To make this part, you'll use gene synthesis. You may use the tools at GeneDesign to design your oligos for making this part by the PCA method. The protocol is here.


Proposed synthesis route: Fully Synthetic (GeneDesign)
Proposed construction file (draft): Template:SBB10 ConstructionFiles JimH sbb11

1) sbb11: sleeping beauty 5'TR

Pool OJIMH001 through OJIMH010, assemble by PCA
PCR OJIMH001/OJIMH010 on PCA reaction	(257 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb11

------------

OJIMH001	PCA assembly of sbb11	CCATAGAATTCATGAGATCTAGTTGAAGTCGGAAGTTTACATACACTTAAG
OJIMH002	PCA assembly of sbb11	GAAAAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTC
OJIMH003	PCA assembly of sbb11	AAGTTGGAGTCATTAAAACTCGTTTTTCAACTACACCACAAATTTCTTGTTAAC
OJIMH004	PCA assembly of sbb11	CTGACTTGCCAAAACTATTGTTTGTTAACAAGAAATTTGTGGTGTAGTTGAAA
OJIMH005	PCA assembly of sbb11	TTAACAAACAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGC
OJIMH006	PCA assembly of sbb11	ACAATTGTTGGAAAAATGACTTGTGTCATGCACAAAGTAGATGTCCTAACTG
OJIMH007	PCA assembly of sbb11	GACACAAGTCATTTTTCCAACAATTGTTTACAGACAGATTATTTCACTTATAATTC
OJIMH008	PCA assembly of sbb11	CCACTGGAATTGTGATACAGTGAATTATAAGTGAAATAATCTGTCTGTAAAC
OJIMH009	PCA assembly of sbb11	TAATTCACTGTATCACAATTCCAGTGGGTCAGAAGTTTACATACACTAAG
OJIMH010	PCA assembly of sbb11	CTGATGGATCCTTAGTGTATGTAAACTTCTGACCC

JCA Notes

  • Correct


sbb13: PhiC31 Integrase

 Source:  pBca9523-Bca1623, pBca9523-Bca1659
 Target Sequence:  DTYAGAYDRQSRERENSSAASPATQRSANEDKAADLQREVERDGGRFRFVGHFSEAPGTSAFGTAERPEFERILNECRAGRLNMIIVYDVSRFSRLKVMDAIPIVSELLALGVTIVSTQEGVFRQGNVMDLIHLIMRLDASHKESSLKSAKILDTKNLQRELGGYVGGKAPYGFELVSETKEITRNGRMVNVVINKLAHSTTPLTGPFEFEPDVIRWWWREIKTHKHLPFKPGSQAAIHPGSITGLCKRMDADAVPTRGETIGKKTASSAWDPATVMRILRDPRIAGFAAEVIYKKKPDGTPTTKIEGYRIQRDPITLRPVELDCGPIIEPAEWYELQAWLDGRGRGKGLSRGQAILSAMDKLYCECGAVMTSKRGEESIKDSYRCRRRKVVDPSAPGQHEGTCNVSMAALDKFVAERIFNKIRHAEGDEETLALLWEAARRFGKLTEAPEKSGERANLVAERADALNALEELYEDRAAGAYDGPVGRKHFRKQQAALTLRQQGAEERLAELEAAEAPKLPLDQWFPEDADADPTGPKSWWGRASVDDKRVFVGLFVDKIVVTKSTTGRGQGTPIEKRASITWAKPPTDDDEDDAQDGTEDVAA
 Vector:  pBjk2741
 Short description: <phiC31>
 Genbank reference: X59938.1
 Flavor:  {<part>} 
 Family:  Phage Integrase

A template for making this part has been constructed as two synthons in plasmids pBca9523-Bca1623 and pBca9523-Bca1659. You will need to use SOEing to splice these two synthons together. Take special note that you are creating the correct flavor for this part.

This part encodes a DNA modifying enzyme

Different DNA modification enzymes are needed in different flavors, so take special note of what type this one should be. DNA modification enzymes are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.

This part is associated with phiC31 integration devices

phiC31 is a bacteriophage integrase. It is somewhat similar in mechanism to Cre recombinase, but it acts on the asymmetric sites attB and attP. It causes these sequences to be recombined to generate attL and attR sequences. This system is useful for integrating large DNAs site-specifically into genomes.

You should read the following papers
References: PMID 14996222, PMID 19002165, PMID 19439387, PMID 12034816


Proposed synthesis route: Modified SOE procedure
Proposed construction file (draft): Template:SBB10 ConstructionFiles JimH sbb13

2) sbb13: PhiC31 Integrase

PCR OJIMH011/OJIMH012 on pBca9523-Bca1623	(949 bp, gp = A)
PCR OJIMH013/OJIMH014 on pBca9523-Bca1659	(938 bp, gp = B)
-------------
PCR PJIMH011/OJIMH014 on A+B	(1843 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb13	{<phiC31>}
-------------
OJIMH011	Forward PCR of Part 1 of PhiC31	ccataGAATTCatgAGATCTGACACGTACGCGGGTGCTTA
OJIMH012	SOEing of Part 1 (R) of PhiC31	AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccg
OJIMH013	SOEing of Part 2 (F) of PhiC31	cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTT
OJIMH014	Reverse PCR of Part 2 of PhiC31	atcagGGATCCCGCCGCTACGTCTTCCGT

JCA Notes

  • Oligos 12 and 13 are switched
  • Otherwise correct
sbb13: PhiC31 Integrase

PCR OJIMH011/OJIMH013 on Bca1623 6-9            (949bp, gp=A)
PCR OJIMH012/CA1674 on Bca1559 7-7              (514bp, gp=B)
PCR CA1675/OJIMH014 on Bca1559 7-1	        (444bp, gp = C)
-------------
PCR PJIMH011/OJIMH014 on A+B+C	(1843 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb13	{<phiC31>}
-------------
OJIMH011	Forward PCR of Part 1 of PhiC31	
ccataGAATTCatgAGATCTGACACGTACGCGGGTGCTTA
OJIMH012	SOEing of Part 1 (R) of PhiC31	
AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccg
OJIMH013	SOEing of Part 2 (F) of PhiC31	
cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTT
CA1674	GGGCGTCGGCGCGCTCCGCAACAAGGTTCGCCCGTTCGCCGCTCTTCTCAG	
PCA assembly of phiCthreeprime (Bca1659)
CA1675	TGCGGAGCGCGCCGACGCCCTGAACGCCCTTGAAGAGCTGTACGAAGACCG	
PCA assembly of phiCthreeprime (Bca1659)
OJIMH014	Reverse PCR of Part 2 of PhiC31	
atcagGGATCCCGCCGCTACGTCTTCCGT


Personal tools