Template:SBB10Project-11956
From OpenWetWare
![]()
Welcome to your project page!
For each part listed, you should:
- Design oligos to make your part
- Write up proper construction files and put it on the Construction Files page
- Put your oligos on the Oligo Log page
- Put your parts into Clotho
You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.
Several references have been provided to give you some background on the biology of your part.
Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.
Finally, you should create a notebook on the main page of the wiki
sbb05: piggieBac 5'TR
Source: Synthetic Target Sequence: ttaaccctagaaagatagtctgcgtaaaattgacgcatgcattcttgaaatattgctctctctttctaaatagcgcgaatccgtcgctgtgcatttaggacatctcagtcgccgcttggagctcccgtgaggcgtgcttgtcaatgcggtaagtgtcactgattttgaactataacgaccgcgtgagtcaaaatgacgcatgattatcttttacgtgacttttaagatttaactcatacgataattatattgttatttcatgttctacttacgtgataacttattatatatatattttcttgttatagatatc Vector: pBjk2741 Short description: piggieBac 5'TR Genbank reference: FJ495179.1 Family: Terminal Repeat
This part encodes a DNA cis element
DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them.
This part is associated with piggyBac transposon devices
piggyBac transposase is a popular enzymes that generates protein-DNA complexes called transposomes from DNAs flanked by "terminal repeats". These terminal repeats, or TR's, are specific cis elements. The transposomes are highly reactive and insert the DNA contained within them randomly into other DNAs (such as a genome).
You should read the following papers
References: PMID 17576687, PMID 18556020, PMID 19252478
This part requires Gene Synthesis
To make this part, you'll use gene synthesis. You may use the tools at GeneDesign to design your oligos for making this part by the PCA method. The protocol is here.
sbb01: N15 Protelomerase
Source: pBca9523-Bca1455, pBca9523-Bca1485
Target Sequence:
MSKVKIGELINTLVNEVEAIDASDRPQGDKTKRIKAAAARYKNALFNDKRKFRGKGLQKRITANTFNAYMSRARKRFDDKLHHSFDKNINKLSEKYPLYSEELSSWLSMPTANIRQHMSSLQSKLKEIMPLAEELSNVRIGSKGSDAKIARLIKKYPDWSFALSDLNSDDWKERRDYLYKLFQQGSALLEELHQLKVNHEVLYHLQLSPAERTSIQQRWADVLREKKRNVVVIDYPTYMQSIYDILNNPATLFSLNTRSGMAPLAFALAAVSGRRMIEIMFQGEFAVSGKYTVNFSGQAKKRSEDKSVTRTIYTLCEAKLFVELLTELRSCSAASDFDEVVKGYGKDDTRSENGRINAILAKAFNPWVKSFFGDDRRVYKDSRAIYARIAYEMFFRVDPRWKNVDEDVFFMEILGHDDENTQLHYKQFKLANFSRTWRPEVGDENTRLVALQKLDDEMPGFARGDAGVRLHETVKQLVEQDPSAKITNSTLRAFKFSPTMISRYLEFAADALGQFVGENGQWQLKIETPAIVLPDEESVETIDEPDDESQDDELDEDEIELDEGGGDEPTEEEGPEEHQPTALKPVFKPAKNNGDGTYKIEFEYDGKHYAWSGPADSPMAAMRSAWETYYS*
Vector: pBjk2741
Short description: rbs.protel!
Genbank reference: U63086.1
Flavor: {rbs.part!}
Family: Protelomerase
A template for making this part has been constructed as two synthons in plasmids pBca9523-Bca1455 and pBca9523-Bca1485 . You will need to use SOEing to splice these two synthons together. Take special note that you are creating the correct flavor for this part, and note that you will need to calculate a strong RBS to place upstream of it.
This part encodes a DNA modifying enzyme
Different DNA modification enzymes are needed in different flavors, so take special note of what type this one should be. DNA modification enzymes are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.
This part is associated with N15 Protelomerase devices
N15 Protelomerase comes from Bacteriophage N15, a virus-like organism that infects E. coli. The special thing about this organism is that it has a linear DNA--well, kindov. The ends of the DNA are special telomere-like sequences that form hairpins. So, there is no sticky end on their genome, the whole genome is just one big self-complementary circular DNA. The elements that make the DNA form this structure are N15 Protelomerase and the cis element it acts upon, called tos. When present in a normal plasmid DNA, tox sites can be cleaved by protelomerase resulting in the terminally-hairpinned linear DNA.
For our purposes, a device along these lines will help get the DNA into the nucleus of the target organism.
You should read the following papers
References: PMID 17988739, PMID 12395149
This part requires the RBS Calculator
Your part includes a ribosome binding site in it. We want to maximize expression of this part, so we want a strong one. Go to http://voigtlab.ucsf.edu/software/. To generate an RBS, paste the DNA sequence for your part from start codon on into the box saying "Protein Coding Sequence." In the "Pre-Sequence" box, put in "GGATCT". In the Target Translation Initiation Rate box put "100000" (100000 is the highest expression level). Then submit it. You'll get an email with an RBS sequence that you can incorporate into your part. Your pre-sequence "GGATCT" should be replaced with BglII restriction site.


