Template:SBB09 28190
From OpenWetWare
![]()
Welcome to your project page!
For each part listed, you should:
- Design oligos to make your part
- Write up proper construction files and put it on the Construction Files page
- Put your oligos on the Oligo Log page
- Put your part sequence on the part document
- Name your parts according to the list here
Tsh Autotransporter
Source: E. coli avain APEC genomic DNA
You are going to construct a display part from the Tsh autotransporter. For background, you should read PMID: 15546669. See pubmed nucleotide sequence AF218073 for the DNA. Also check out the protein sequence at AAA24698:
Region 855..1076
/region_name="PL1_Passenger_AT"
/note="Pertactin-like passenger domains (virulence
factors), C-terminal, subgroup 1, of autotransporter
proteins of the type V secretion system of Gram-negative
bacteria. This subgroup includes the passenger domains of
Neisseria and Haemophilus IgA1 proteases...; cd01343"
/db_xref="CDD:29328"
Region 1113..1358
/region_name="Autotransporter"
/note="Autotransporter beta-domain; cl02365"
/db_xref="CDD:121263"
You will construct your part to start with amino acid 855 and extend to the stop codon.
This part encodes a N-terminal display protein
Your displayer part should be of the {<part!} style (no start, with stop). There should be NO prepro sequence in your part. You should design your construction file to insert your part into plasmid pBca9495KC-Bca1144#5 using EcoRI and BamHI. The map of this plasmid is here.
Ice Nucleation Protein
Source: pBca1256-Bca1346
You are going to make a tilda-style part (see notes below) derived from ice nucleation protein. INP is one of the most commonly-used display methods and you should read up on it starting with reference PMID: 14705004 and a pubmed search of "ice nucleation protein display coli".
You can download the template map for your part here. The 3' end of this part is already properly biobricked, so all you need is a new oligo for the 5' end. In your construction file, you should make use of this oligo:
BBa_G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc
This part encodes a C-terminal display protein
Your displayer part should be of the
{a~part>}style (no stop). The tilda business is our preferred way of encoding the rbs/cds junction. Basically, the BglBrick scar (GGATCT) will end up superimposed over the Shine-Delgarno sequence. So, the tilda refers to the inclusion of 4 addition bases before the start codon, and the "a" refers to the fact that you'll make your part have an ATG start codon.
You'll need to include part of the native 5'UTR and prepro region of your protein in the part. To do this, you first of all need the complete sequence of your protein and it's 5' UTR (the region upstream of the start codon). To illustrate this, here's an example:
You can download the raw sequence of the fimH region annotated here.
Locate the start codon and make sure it's the real start. Sometimes starts are GTG or TTG! If it is TTG or GTG, change it to ATG. Now, include the next four 5' bases and then put in your BglII site.
So, the start for this fimH part is:
atgaaacgagttattaccc...
The next 4 upstream bases are TGTA, so my new sequence is:
AGATCTtgtaatgaaacgagttattaccc
and the forward oligo would be something like:
ccaaaGAATTCatgAGATCTtgtaatgaaacgagttattaccctgYou should design your construction file to insert your part into plasmid pBca9495CA-Bca1144#5 using EcoRI and BamHI. The map of this plasmid is here.


