Table 2

From OpenWetWare

Jump to: navigation, search

Sequence


CgTAACCgTCACgTTg
CATATAACTAAATATg
CATggTCAgACgTTgT
AAAATCCCgAAAATCC
gCCAgCTTTCCggCACATCggCCT
gAgTAACATTAATATT
ATgAACggATTTTTgA
TTTggAACCgAgATAg
CggTCCACCgCCTggCCCTgAgAg
ATgAATCggCCAACgCgggTgCCT
TgTgTAggTACCAAAA
CCTCATATgCgggAgA
gAgACAgTCTgAgTAA
AACCgTTCTTTAgAAC
gCATgCCTggATCCCC
CCTCAgAggAAAAggTATATTTTCgTTTAgCTCATTTCgC
CCAAgCTTAAgTTggg
ggCCAgTgAgCTCgAA
gTgTAgATATCAAAAA
CCAATAAAgCTgTAgC
TATCCgCTgggTACCg
CCAgTCACgCgCAACT
ggAACgCCCCCCggTT
AAATCggCTgTTTgATCACCAgTg
CATACAggCAAggCAACATTAACA
TgTATAAggAgAATCg
CCAgTTTgACCgTAAT
gTTgggAAATTCgCCA
AAAACgACgggTTTTC
TCCgTgggATTAAATg
TTCTACTACAACTAAA
CgAACCAgCgCgTTTT
gCggATTggCCAgCTT
AgggggATCCAgCTgg
ACgACAgTAACAAACg
CATATgTATAgCTgAT
AATAACCTAAATggTC
gCAggTCggTgCTgCA
AATgAgTgAgCTAACTCTgCATTA
TgTAAACgCTgAgAgT
AAAATTCgCAAATATT
AgACgggCgAAATTgT
CACACAACACTCTAgA
ggATAAAACAACgCAA
ggTTgAgTTgCAgCAA
AgATCgCAACCCgTCg
ACATTATgAAAgCTAAATCggTTg
AgTTgATTCgAACgAg
AAgAggTCCTTTTgAT
TTTTgTTAAggAAgAT
TCCTgTgTTTCgTAAT
ATACgAgCgggCgCCAgggTggTT
AAAgCCTggCggggAgAggCggTT
TgCAATgCACCCTgTA
ggATggCTATTTTTgC
ATTgCCCTTAgCTgTT
TgCgTATTCggAAgCATAAAgTgT
AAACTAgCgCCggAgA
AgCCTTTATAgCAAAA
TTTCATTCgTTTgACCATTAgATA
CgCgAgCTATTTgggg
TCTggAAggTACggTg
TTTCTTTTCACAATTC
gggTAgCTCAAATCAC
gTgCCggAAggggACg
CATCAATAATTTTAAAATACTTTT
TATTAAAgTAAATCAA
CCAAAAACTAATCgTA
gggATAgggTCTggCC
AAAgCgCCTgCATCTg
AAATTAATTgATATTC
TTCCTgTAAATCAgCT
TAgATTTACTTCAAAgAATTCgAg
CAATAAAgggCATCAA
CTATTACgCgCTTCTg
ggTgCgggAACCAggC
gAgATCTAAAAggCCg
AgAATAgCgCTggTTT
TCATCAACCATTAAAT
AATTgCTCgTACCTTTAAA
CAgCAggCAACAgCTg
AggCgATTCCTCTTCg
AAAgggTgAAgATTCA
ACTCCAACgTCAAAggAgAgTCCA
TTgCgTTgCgCTCACTCAgTCggg
gCAAACAACAAAggCTATCAggTCAT
AAACCTgTCgTgCCAgCACATTAA
CATTTTTTgAAAAgCC
TAATTCgCAACCAATA
gATAATCAATgTCAAT
TAACgCCAgggCgATC
AgCTTAATTgCTgAATAACAggTCAggATTAg
TTCAggCTgggCgCAT
gAAAAACCgTCTATCATTgTTCCA


Personal tools