User contributions
From OpenWetWare
(Latest | Earliest) View (newer 50) (older 50) (20 | 50 | 100 | 250 | 500)
- 04:19, 3 May 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-5-3 (top)
- 04:05, 3 May 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-5-3 (New page: <syntax type='python'> from Bio import SeqIO from Bio.Blast import NCBIWWW from Bio.EUtils import DBIdsClient import xml.dom.minidom from xml.dom.minidom import parse, parseString from t...)
- 06:44, 1 May 2007 (hist) (diff) User:Kfifer (→Biophysics 101) (top)
- 06:42, 1 May 2007 (hist) (diff) User:Kfifer (→Biophysics 101)
- 06:38, 1 May 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-5-1
- 06:37, 1 May 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-5-1 (New page: So the next step of the project is combining everything. As I see it, there are a few separate pipelines: * Seq->blast->gene names (this much is Zach) ->polyphan (Mike needs to do this) o...)
- 06:33, 1 May 2007 (hist) (diff) User:Kfifer (→Biophysics 101)
- 03:02, 24 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-24 (top)
- 02:49, 24 April 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-24 (New page: * we're going to pull the genbank file down in its entirety and parse for relavant features using the code i wrote last time. (we gave up the battle to get just a piece of the genbank file...)
- 02:00, 19 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-19 (top)
- 01:59, 19 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-19
- 01:59, 19 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-19
- 01:57, 19 April 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-19 (New page: This script does a regular BLAST lookup and parses out the top human hit and relevant info (hit to, hit from, hit id, hit def, hit seq, etc). The next step will be to get the relevant par...)
- 23:26, 16 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-17 (→Project Progress) (top)
- 00:57, 16 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-17 (→Project Progress)
- 00:55, 16 April 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-15 (New page: This version of the full script pickles the output to a file in addition to printing. Below is code to read in and unpickle what was written (and then print that. A modified version of th...) (top)
- 23:12, 15 April 2007 (hist) (diff) IGEM:Harvard/2006/Container Design 4/Python Code/Pickle Scripts (top)
- 23:11, 15 April 2007 (hist) (diff) User:Kfifer (→Summer 2006)
- 23:11, 15 April 2007 (hist) (diff) User:Kfifer (→Summer 2006)
- 23:08, 15 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-17 (→Project Plan)
- 22:31, 15 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/04/12
- 22:31, 15 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-17
- 15:51, 15 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-17 (→Project Plan)
- 15:50, 15 April 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-17 (New page: == Project Plan == * My work thus far has focused both on general project management and also on part of the basic script - I worked on the part that went from sequence to snp number with...)
- 15:40, 15 April 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-4-5 (New page: == The Project Thus Far == Our project consists of a number of parts. Its central feature takes a DNA sequence and uses BLAST/SNP to determine whether or not the sequence has any single ...) (top)
- 21:11, 2 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Xiaodi Wu/2007-3-20 (→Progress thus far) (top)
- 20:31, 2 April 2007 (hist) (diff) User:Kfifer
- 20:27, 2 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Xiaodi Wu/2007-3-20 (→Progress thus far)
- 20:27, 2 April 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Xiaodi Wu/2007-3-20
- 08:51, 22 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Project (→Overview)
- 08:50, 22 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Project (→Project Sections)
- 07:57, 22 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Project (→Project Sections)
- 07:57, 22 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Project (→Project Sections)
- 07:27, 20 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Xiaodi Wu/2007-3-20
- 09:33, 16 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15 (top)
- 00:19, 16 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 01:58, 15 March 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-2-27 (New page: <pre> # Katie Fifer # asst3 - sequence comparison #! /usr/bin/env python import os import re from Bio import Clustalw from Bio import Translate from Bio.Align import AlignInfo from Bio.A...) (top)
- 01:52, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 01:26, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 01:24, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 01:05, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 01:04, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 00:45, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 00:45, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 00:45, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 00:42, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 00:41, 15 March 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15
- 00:35, 15 March 2007 (hist) (diff) N Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-3-15 (New page: <pre> Query 1 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 42968870 CACCC...)
- 12:18, 20 February 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-2-20 (top)
- 04:24, 20 February 2007 (hist) (diff) Harvard:Biophysics 101/2007/Notebook:Katie Fifer/2007-2-20
(Latest | Earliest) View (newer 50) (older 50) (20 | 50 | 100 | 250 | 500)


