SEED/2009/Day 4

Morning

• Set up 50ul PCRs with 2 different forward RBS primers
  • 5ul 10x NovaTaq Buffer with MgCl₂
  • 1ul dNTP mix (10mM each dNTP)
  • 1ul reverse primer (VR)
  • 1ul RBS specific forward primer
  • 0.25ul NovaTaq DNA polymerase
  • 0.5ul DNA template of E0050 (10ng)
  • rest PCR grade water
• Cycle 30 times
  • 30s@94C
  • 30s@55C
  • 1m@72C
• Pour gel

Afternoon

• Run plasmid digest and PCRs on gel
• Cut out bands and save in freezer

Lecture

• Review units
  • Volume (L)
  • Mass (g)
  • Moles (mol)
  • Molecular weight (Da)
  • Concentration
    • % w/v (e.g. 1% agarose)
    • % v/v (e.g. 70% ethanol)
    • mass/volume (e.g. ng/ul)
    • molarity (e.g. 1M NaCl)
    • factors (e.g. 10x buffer)
• Prefixes (milli, micro, nano, pico)
• PCR discussion
• What is Synthetic Biology?
  • Tie in Comic
  • General, Very High Level Methods (Standardization, Abstraction, Encapsulation)
  • General hierarchy (Parts, Devices, Systems)
  • Rational Design from Ground Up
• Why should we care?
  • Project Ideas Homework Discussion
  • Environment, Energy, Medicine, Materials, Chemicals, Computing
  • Understanding of Regulation, Function, Design (Minimal systems)

Instructor Preparation

• Oligos
  • VR: attaccgcctttgagtgagc
  • B0030.E0040-F: gaattctctagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttc
  • B0031.E0040-F: gaattctctagagtcacacaggaaacctactagatgcgtaaaggagaagaacttttc
  • B0032.E0040-F: gaattctctagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttc
  • B0033.E0040-F: gaattctctagagtcacacaggactactagatgcgtaaaggagaagaacttttc
  • B0034.E0040-F: gaattctctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc
  • B0035.E0040-F: gaattctctagagattaaagaggagaatactagatgcgtaaaggagaagaacttttc
• Pairs of RBS primers to assign to groups (selected based on estimated strength):
  • B0030 & B0032
  • B0031 & B0035
  • B0033 & B0034
  • B0032 & B0033
  • B0031 & B0034
  • B0030 & B0035