SBB13Ntbk - Mar7

From OpenWetWare

Jump to: navigation, search
PCA quiC-4 - oligo1-16                     (464bp, pca1)
PCR pca1 with quiC-NewForward/Reverse      (418bp, pca2)
Digest pca2                                (EcoRI/BglII, 402+10+6,L, pcrdig)
Digest pBca9145-Bca144                     (EcoRI/BglII, 2958+9, L, vectdig)
Ligate pcrdig and vectdig                  (pBca9145-quiC4)
-------------------------
>oligo1
AAAAGTTTCAATGCCATCTGTAACAGCCAATGTAACAGACCATTTGGGAGCTAC

>oligo2
AACTTTGCTGGCTCGATTACAACACCACCTCCCCTAGATGAGACGATGCAGATCT

>oligo3
AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAGGTCTCAGGATCCCCT

>oligo4
ACAAAATTGCAATGCTATTCCTAATCAAGGTATTCAAGCTCCTAAATTGACAGTT

>oligo5
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTAGGGGAG

>oligo6
ATCAGAATTATCTTCTGCCGTAAAGATGAGGGGATCCTGAGACCTGAGACGGCA

>oligo7
CATCTTTACGGCAGAAGATAATTCTGATGTAGCTCCCAAATGGTCTGTTACATT

>oligo8
GAAGCGTTTCTATTACCAAAGAACTCTACATTATATCTTTGATTTGGAGTACCCT

>oligo9
GGCTGTTACAGATGGCATTGAAACTTTTGGTGCCCAGTTGGCTTTTGCCAATCC

>oligo10
GTGGTGTTGTAATCGAGCCAGCAAAGTTACAGAAAACCTGTACTCAACCAAATCA

>oligo11
TAGAGTTCTTTGGTAATAGAAACGCTTCATCTTCAGAAGCAGAACAATACTTAGG

>oligo12
TCAAAGAAACAATTGACCGTTGAAGTCAAGGGTACTCCAAATCAAAGATATAATG

>oligo13
TGACTTCAACGGTCAATTGTTTCTTTGAAACTGTCAATTTAGGAGCTTGAATACC

>oligo14
TTCTATAGTCGTAGTAACCGATCACCAAGGATTGGCAAAAGCCAACTGGGCACC

>oligo15
TTGATTAGGAATAGCATTGCAATTTTGTTGATTTGGTTGAGTACAGGTTTTCTGT

>oligo16
TTGGTGATCGGTTACTACGACTATAGAACCTAAGTATTGTTCTGCTTCTGAAGAT

>quiC4-NewForward
ccaaaGAATTCCGTCTCATCTAGGGGAGGTGGTGTTGTAATC

>quiC4-NewReverse
gactgAGATCTCGTCTCAGGTCTCAGGATCCCCTCATC

pca1:
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCTAGGGGAGGTGGTGTTGTAATCGAGCCAGCAAAGTTACAGAAAACCTGTACTCAACCAAATCAACAAAATTGCAATGCTATTCCTAATCAAGGTATTCAAGCTCCTAAATTGACAGTTTCAAAGAAACAATTGACCGTTGAAGTCAAGGGTACTCCAAATCAAAGATATAATGTAGAGTTCTTTGGTAATAGAAACGCTTCATCTTCAGAAGCAGAACAATACTTAGGTTCTATAGTCGTAGTAACCGATCACCAAGGATTGGCAAAAGCCAACTGGGCACCAAAAGTTTCAATGCCATCTGTAACAGCCAATGTAACAGACCATTTGGGAGCTACATCAGAATTATCTTCTGCCGTAAAGATGAGGGGATCCTGAGACCTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

pca2: ccaaaGAATTCCGTCTCATCTAGGGGAGGTGGTGTTGTAATCGAGCCAGCAAAGTTACAGAAAACCTGTACTCAACCAAATCAACAAAATTGCAATGCTATTCCTAATCAAGGTATTCAAGCTCCTAAATTGACAGTTTCAAAGAAACAATTGACCGTTGAAGTCAAGGGTACTCCAAATCAAAGATATAATGTAGAGTTCTTTGGTAATAGAAACGCTTCATCTTCAGAAGCAGAACAATACTTAGGTTCTATAGTCGTAGTAACCGATCACCAAGGATTGGCAAAAGCCAACTGGGCACCAAAAGTTTCAATGCCATCTGTAACAGCCAATGTAACAGACCATTTGGGAGCTACATCAGAATTATCTTCTGCCGTAAAGATGAGGGGATCCTGAGACCTGAGACGAGATCTcagtc 

final product:
GATCTtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacGGATCTGAAAGAGGAGAAAGGATCTatggcgagtagcgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataaGGATCTccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggAATTCCGTCTCATCTAGGGGAGGTGGTGTTGTAATCGAGCCAGCAAAGTTACAGAAAACCTGTACTCAACCAAATCAACAAAATTGCAATGCTATTCCTAATCAAGGTATTCAAGCTCCTAAATTGACAGTTTCAAAGAAACAATTGACCGTTGAAGTCAAGGGTACTCCAAATCAAAGATATAATGTAGAGTTCTTTGGTAATAGAAACGCTTCATCTTCAGAAGCAGAACAATACTTAGGTTCTATAGTCGTAGTAACCGATCACCAAGGATTGGCAAAAGCCAACTGGGCACCAAAAGTTTCAATGCCATCTGTAACAGCCAATGTAACAGACCATTTGGGAGCTACATCAGAATTATCTTCTGCCGTAAAGATGAGGGGATCCTGAGACCTGAGACGA
Personal tools