SBB13Ntbk-LarryLi

From OpenWetWare

Jump to: navigation, search

~~!~~

Larry Li 14:47, 5 March 2013 (EST)

CCOMT3 Construction File

Mix oligos (1-16) for one synthon, do PCA1 protocol              (453 bp, pca1)

PCR pca1 with external oligos (Newfoward and Newreverse) by PCA2 protocol         (407 bp, pca2)

Digest pca2 with EcoRI/BglII, gp                 (391+11+5 bp, pcr_dig)
 
(get pre-digested vector from JCA of pBca9145-Bca1144)  (EcoRI/BamHI, vect_dig)
 
Ligate pcr_dig and vect_dig

Oligo List:

>CCOMT-3_oligo_1	TTTGGAATAGAAACAAACATGTCACCTCCGACATGTTGAGACGATGCAGATCTC
>CCOMT-3_oligo_2	TTCCTTACCACCTGGATTGTGGGCTAACATGATTACGTCAATGTGGACTACAC
>CCOMT-3_oligo_3	TTAGCCCACAATCCAGGTGGTAAGGAAAGAACACAGAAGGAGTTTGAAGACTT
>CCOMT-3_oligo_4	GGCTTTGCCTGATAATGGTAAAGTTATTGTTGCCGAGTGCATTTTACCTGTCG
>CCOMT-3_oligo_5	GGCCAAGGGTGCAGGTTTCCAGGGATTCAAGGTACATTGTAACGCATTTAATA
>CCOMT-3_oligo_6	CTTTAGTTGCTAAAGATGAATCTGGTGCGACAGGTAAAATGCACTCGGCAACA
>CCOMT-3_oligo_7	CTGTCATGATTGGTCTGACGAACATTGCTTGAAATTCTTAAAGAATTGTTATGA
>CCOMT-3_oligo_8	CCTTCTTTAAGAACTCCATAATGTATGTATTAAATGCGTTACAATGTACCTTG
>CCOMT-3_oligo_9	CATACATTATGGAGTTCTTAAAGAAGGTTGGATCCTGAGACCTGAGACGGCAT
>CCOMT-3_oligo_10	CACCAGATTCATCTTTAGCAACTAAAGGTGTAGTCCACATTGACGTAATCATG
>CCOMT-3_oligo_11	CAATGTTCGTCAGACCAATCATGACAGATCCATTTCATAAAGACGGCATCAGCC
>CCOMT-3_oligo_12	ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAACATGTCGG
>CCOMT-3_oligo_13	ATAACTTTACCATTATCAGGCAAAGCCTCATAACAATTCTTTAAGAATTTCAAG
>CCOMT-3_oligo_14	AGGTGACATGTTTGTTTCTATTCCAAAGGCTGATGCCGTCTTTATGAAATGGAT
>CCOMT-3_oligo_15	AATCCCTGGAAACCTGCACCCTTGGCCAAGTCTTCAAACTCCTTCTGTGTTCT
>CCOMT-3_oligo_16	AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCAGGTCTCAGGATCCAA

>CCOMT3-NewForward
ccaaaGAATTCCGTCTCAACATGTCGGAGGTGAC

>CCOMT3-NewReverse
gactgAGATCTCGTCTCAGGTCTCAGGATCCAAC

PCA1 Product:
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAACATGTCGGAGGTGACATGTTTGTTTCTATTCCAAAGGCTGATGCCGTCTTTATGAAATGGATCTGTCATGATTGGTCTGACGAACATTGCTTGAAATTCTTAAAGAATTGTTATGAGGCTTTGCCTGATAATGGTAAAGTTATTGTTGCCGAGTGCATTTTACCTGTCGCACCAGATTCATCTTTAGCAACTAAAGGTGTAGTCCACATTGACGTAATCATGTTAGCCCACAATCCAGGTGGTAAGGAAAGAACACAGAAGGAGTTTGAAGACTTGGCCAAGGGTGCAGGTTTCCAGGGATTCAAGGTACATTGTAACGCATTTAATACATACATTATGGAGTTCTTAAAGAAGGTTGGATCCTGAGACCTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

PCA2 Product:
ccaaaGAATTCCGTCTCAACATGTCGGAGGTGACATGTTTGTTTCTATTCCAAAGGCTGATGCCGTCTTTATGAAATGGATCTGTCATGATTGGTCTGACGAACATTGCTTGAAATTCTTAAAGAATTGTTATGAGGCTTTGCCTGATAATGGTAAAGTTATTGTTGCCGAGTGCATTTTACCTGTCGCACCAGATTCATCTTTAGCAACTAAAGGTGTAGTCCACATTGACGTAATCATGTTAGCCCACAATCCAGGTGGTAAGGAAAGAACACAGAAGGAGTTTGAAGACTTGGCCAAGGGTGCAGGTTTCCAGGGATTCAAGGTACATTGTAACGCATTTAATACATACATTATGGAGTTCTTAAAGAAGGTTGGATCCTGAGACCTGAGACGAGATCTcagtc

On Thursday we will be doing the PCA.

Larry Li 13:06, 12 March 2013 (EDT)

On Thursday we performed the PCA1 protocol

38 uL ddH2O

5 ul 10x expand buffer

5 ul 2mM dNTPs

1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)

0.75 ul Expand polymerase

Program (can run JCA/PCA1)

2 min initial denature at 94oC

30 sec denature at 94oC

30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]

30 sec extension at 72oC

repeat 2-4 30 times total


Today we performed a zymo cleanup on the assembly reaction and will perform amplification

For the zymo cleanup we


Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.

Transfer into the Zymo column (small clear guys)

spin through, discard waste.

Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)

spin through, discard waste.

Add 200 uL of Zymo Wash Buffer

spin through, discard waste.

spin for 90 seconds, full speed to dry.

elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction


and for the amplification


1 ul each outer oligo (10 uM)

1 ul purified pca product

.5 ul phusion

10 ul 5x phusion buffer

5 ul 2mM dNTPs

32.5 ul H2O

Program

2 min initial denature at 94oC

30 sec denature at 94oC

30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]

30 sec extension at 68oC

repeat 2-4 30 times total

Larry Li 12:42, 14 March 2013 (EDT)

Image:2013_03_13-JCA-gel1.jpg


Sample was run in gel in lane 10. Will perform zymo cleanup, digest and gel purify today.

Heated and dissolved gel in ADP buffer and put in freezer.

Larry Li 12:54, 19 March 2013 (EDT)

Finished zymo cleaning up today.

Larry Li 13:26, 21 March 2013 (EDT)

Today we performed ligation, transformation and plating.

We did

  • Set up the following reaction:
 6.5uL ddH2O
 1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
 1uL Vector digest
 1uL Insert digest
 0.5uL T4 DNA Ligase
  • Pound upside down on the bench to mix
  • Give it a quick spin to send it back to the bottom of the tube
  • Incubate on the benchtop for 30min
  • Put on ice and proceed to the transformation

Then

  1. Thaw a 200 uL aliquot of cells on ice
  2. Add 50 uL of water to the cells (if greater volume is desired)
  3. Add 30 uL of KCM to the cells 
  4. Put your ligation mixture on ice, let cool a minute or two (for Miniprep product, dilute by 10, then use 1uL of dilution)
  5. Add 70 uL of the cell cocktail to the ligation, stir to mix
  6. Let sit on ice for 10 min
  7. Heat shock for 90 seconds at 42 (longer incubation may work better)
  8. Put back on ice for 1 min
  9. Add 100uL of 2YT
 10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight

Larry Li 12:31, 2 April 2013 (EDT)

Troubleshoot

We restarted from digestion of PCA2 product. Followed same protocol as above. Purified digestion and put in freezer

Larry Li 14:30, 4 April 2013 (EDT)

Redid ligation, transformation and plating. Note we did not add 50ul of water this time.

Larry Li 13:11, 9 April 2013 (EDT)

Picked colonies. Added 5 ml of LB + AMP then picked colonies and dropped into culture. Picked 4 colonies. Set to incubate overnight at 37C.

Larry Li 13:30, 18 April 2013 (EDT)

Purified DNA from cells using miniprep and then ran gel to check for band and presence of insert. Selected two best colonies for synthesis.

Larry Li 12:56, 16 April 2013 (EDT)

Analyzed sequencing data and selected correct vectors.

Larry Li 13:15, 23 April 2013 (EDT)

Transformed, rescued and plated cells.Followed previous transformation protocol but rescued for 1 hour.

Larry Li 13:20, 25 April 2013 (EDT)

Performed Miniprep, ran analytic gel and sent for sequencing.

Larry Li 13:04, 2 May 2013 (EDT)

Analyzed sequence data

Personal tools