From OpenWetWare
Vanillin - quiC-3
PCA quiC-3_oligo_1-16 (460 bp, pca1)
PCR pca1 with quiC-3_oligo_11/quiC-3_oligo_15 (460 bp, pca2)
Digest pca2, gp (EcoRI/BamHI, 20+415+25 bp, pcr_dig)
(get pre-digested vector from JCA of pBca9145-Bca1144 (EcoRI/BamHI, vect_dig)
Ligate pcr_dig and vect_dig (pBca9145-quiC-3)
-------------------------------
<quiC-3_oligo_1
TGATCTAATTGCAATTCCAATCCTGTTTCCATGAACCTTATTTGAATCGAA
<quiC-3_oligo_2
TCGTAGGTAATAAGTTCGAGAACTATTCTGACGGTTTGCAAATCAATTGGG
<quiC-3_oligo_3
TCCTTCGTGTTCCAAAGCTGGAACACCGAAAACGATTGCACCTAATCTTTG
<quiC-4_oligo_4
TCAATTTAACAGGAGATGGTAACATTTTCGATTCAAATAAGGTTCATGGAA
<quiC-5_oligo_5
GTGTTCCAGCTTTGGAACACGAAGGATTTGTAGGTTCTATGAGACGGCATG
<quiC-6_oligo_6
GTAAAAGAAACTACATTGCTTATAATGAATTGACAAATAACTCTTTGGGTT
<quiC-7_oligo_7
CATTAACTAAGAACCAAATTTGGGATAATGGAAAGGACATCAAGAGGTGTG
<quiC-8_oligo_8
ATTTGGAACACAAGAACCTCCAGCTTCACACCTCTTGATGTCCTTTCCATT
<quiC-9_oligo_9
ATTATAAGCAATGTAGTTTCTTTTACCCCAATTGATTTGCAAACCGTCAGA
<quiC-10_oligo_10
ATCCCAAATTTGGTTCTTAGTTAATGTGATTCTTGCATTAGCATCCTTTTC
<quiC-11_oligo_11
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAAATGCTG
<quiC-12_oligo_12
ATAGTTCTCGAACTTATTACCTACGACAGCATTTGAGACGATGCAGATCTCA
<quiC-13_oligo_13
ACAGGATTGGAATTGCAATTAGATCAGAAAAGGATGCTAATGCAAGAATCA
<quiC-14_oligo_14
AATGTTACCATCTCCTGTTAAATTGAAACCCAAAGAGTTATTTGTCAATTC
<quiC-15_oligo_15
AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAACCTACAAA
<quiC-16_oligo_16
AAGCTGGAGGTTCTTGTGTTCCAAATCAAAGATTAGGTGCAATCGTTTTCG
----------------------------------
pca1/pca2:
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAAATGCTGTGAGATCTGCATCGTCTCAAATGCTGTCGTAGGTAATAAGTTCGAGAACTATTCTGACGGTTTGCAAATCAATTGGGGTAAAAGAAACTACATTGCTTATAATGAATTGACAAATAACTCTTTGGGTTTCAATTTAACAGGAGATGGTAACATTTTCGATTCAAATAAGGTTCATGGAAACAGGATTGGAATTGCAATTAGATCAGAAAAGGATGCTAATGCAAGAATCACATTAACTAAGAACCAAATTTGGGATAATGGAAAGGACATCAAGAGGTGTGAAGCTGGAGGTTCTTGTGTTCCAAATCAAAGATTAGGTGCAATCGTTTTCGGTGTTCCAGCTTTGGAACACGAAGGATTTGTAGGTTCTATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
3/8/13 -- Assembly Step:
Assembly:
1. 38 uL ddH2O
2. 5 ul 10x expand buffer
3. 5 ul 2mM dNTPs
4. 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
5. 0.75 ul Expand polymerase
Program (can run JCA/PCA1)
1. 2 min initial denature at 94oC
2. 30 sec denature at 94oC
3. 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]
4. 30 sec extension at 72oC
5. repeat 2-4 30 times total
3/12/13 -- Zymo Cleanup and Amplification
Zymo Cleanup:
1. Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
2. Transfer into the Zymo column (small clear guys)
3. spin through, discard waste.
4. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
5. spin through, discard waste.
6. Add 200 uL of Zymo Wash Buffer
7. spin through, discard waste.
8. spin for 90 seconds, full speed to dry.
9. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
Amplification:
1. 1 ul each outer oligo (10 uM)
2. 1 ul purified pca product
3. .5 ul phusion
4. 10 ul 5x phusion buffer
5. 5 ul 2mM dNTPs
6. 32.5 ul H2O
Program
1. 2 min initial denature at 94oC
2. 30 sec denature at 94oC
3. 30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]
4. 30 sec extension at 68oC
5. repeat 2-4 30 times total
3/14/13- Zymo Cleanup, Digestion, Run on gel
Digestion:
1. 8uL of eluted PCR product
2. 1uL of NEB Buffer 2
3. 0.5uL EcoRI
4. 0.5uL BamHI
5. Incubate at 37 degrees on the thermocycler for 1hr
Run on gel
cut out band
begin gel purification--stop after gel is dissolved in ADB buffer
3/19/13- Finish gel cleanup
gel purification:
1. cut out bands minimizing extra gel matter.
2. put in ependorf tube and add 600uL of Zymo ADB buffer (brown bottle).
3. heat at 55, shake and/or vortex until the gel has dissolved.
4. If the DNA is <300bp add 250uL of isopropanol
5. transfer into the Zymo column inside a collection tube (small clear guys)
6. spin through, discard waste.
7. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
8. spin through, discard waste.
9. Add 200 uL of Zymo Wash Buffer
10. spin through, discard waste.
11. spin for 90 seconds, full speed to dry.
12. elute with water into a fresh Eppendorf tube
3/21/13- ligation, transformation
ligation:
6.5uL ddH2O
1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
1uL Vector digest
1uL Insert digest
0.5uL T4 DNA Ligase
Mix
Incubate on bench for 30min then put on ice
transformation:
1. Thaw a 200 uL aliquot of cells on ice
2. Add 50 uL of water to the cells (if greater volume is desired)
3. Add 30 uL of KCM to the cells
4. Put your ligation mixture on ice, let cool a minute or two (for Miniprep product, dilute by 10, then use 1uL of dilution)
5. Add 70 uL of the cell cocktail to the ligation, stir to mix
6. Let sit on ice for 10 min
7. Heat shock for 90 seconds at 42 (longer incubation may work better)
8. Put back on ice for 1 min
9. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour
10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight
4/2/13- Only two colonies on the plate--> system wide failure
redo digestion of zymo cleanup of PCR product from 3/14/13 tube
run the gel cleanup on a gel to see if the digestion had worked- there is a band
Do a zymo cleanup of the new digestion instead of running it on a gel
4/4/13- ligation and tranformation
for transformation: use 30microliters of KCM and no water
4/9/13- inoculate 4 tubes of LB (5mL) with colonies
4/11/13- miniprep 3mL of culture from each tube; digest with XhoI and EcoRI; run a gel to select 2 good clones
4/16/13- Golden gate reaction to assemble quiC gene
1. 3.5 uL ddH20
2. 1 uL ligase buffer
3. 0.5 uL ligase
4. 0.5 uL BsmBI
5. 1 uL EACH CONSTRUCT (4 total)
6. 0.5 uL vector
Thermocycler-- run reaction for 5 hours
4/18/13- Transformation (with recovery in 2YT) and plate on chloramphenicol plates
4/19/13- Golden gate did not work (possibly reason is that we used too much DNA)
Set up Golden gate reaction again:
1. 6.5 uL ddH20
2. 1 uL ligase buffer
3. 0.5 uL ligase
4. 0.5 uL BsmBI
5. 1 uL mix of the 4 constructs
6. 0.5 uL vector
4/23/13- Transformation (with recovery in 2YT) and plate
4/25/13- Miniprep culture
Digest (mapping)
6.5 uL H20
2 uL plasmid
1 uL NEB4
0.5 uL BsaI
Incubate at 37 for 30min
Run on gel- Reaction did not work (band not correct size)
Set up new reaction:
10 uL NEB3
1 uL EACH synthon
1 uL vector
1 uL BsmBI
83 uL H20
4/30/13- Miniprep culture