SBB09 Oligos

From OpenWetWare

Jump to: navigation, search

Put your oligo sequences into this page. Separate each column with tabs:

Ost001F	Forward oligo for upaG	ccaaaGAATTCatgAGATCTgttgagatggataacaaactg
Ost002R	Reverse oligo for upaG	ctagcGGATCCttaCCACtgaataccggcaccgag
Ost003F	Forward construction for HydroxyapatiteBP	ccaaaGAATTCatgAGATCTgcgccgtggcatctgagcagccagtatag
Ost004R	Reverse construction for HydroxyapatiteBP	ctagcGGATCCggtgcggctatactggctgctcagatgc
Ost005F	Forward oligo for Beta Helix Repeats	ccaaaGAATTCatgAGATCTagtgtcttcaacggcaccg
Ost006R	Reverse oligo for Beta Helix Repeats	ctagcGGATCCtgtacgcatgacaaatgctgac
Ost007F	Forward construction of Magnetic Bead BP basic part	ccaaaGAATTCatgAGATCTCACCACAAATACTGGCACCG
Ost008R	Reverse construction of Magnetic Bead BP basic part	ctagcGGATCCACGGTGCCAGTATTTGTGGTG
Oso001	Cloning of Ag43, short	ccataGAATTCatgAGATCTggtgaaaacaacagcgtccg
Oso002 	Cloning of Ag43	GCttaggatcctcagaaggtcacattcagtg
Oso003 	Cloning of PL2_Passenger_AT to Autotransporter Ag43	ccataGAATTCatgAGATCTacgctgacgctgaacgacag
Ojb001F	Forward construction of CPG_L2 N term part	ctctgGAATTCatgAGATCTgaggaaaggaacgactgg
Ojb001R	Reverse construction of CPG_L2 N term part	catgtGGATCCttacgcgctataatctaccggcc
Ojb002F	Forward construction of CPG_L2 C term part	ctctgGAATTCatgAGATCTggtaaacgtggaacgtggtt
Ojb003F	Forward removal of XhoI site in CPG_L2	actattatctTgagcgcggc
Ojb003R	Reverse removal of XhoI site in CPG_L2	gccgcgctcAagataatagt
Ojb004F	Forward SOEing oligo for CPG_L2	GGATCTAAGTCTCGTCGCgaggaaaggaacgactggca
Ojb004R	Reverse SOEing oligo for CPG_L2	GCGACGAGACTTAGATCCgaacgagtaatttacgccga
Ojb005F	Forward construction of CPG_L6 N term part	ctctgGAATTCatgAGATCTgaggaaaggaacgactgg
Ojb005R	Reverse construction of CPG_L6 N term part	catgtGGATCCttactgccagtcccagttactcc
Ojb006F	Forward construction of CPG_L2 C term part	ctctgGAATTCatgAGATCTgatgatattgaacgtgaagg
Ojb002R	Reverse construction of CPG_L2 C term part	catgtGGATCCgaacgagtaatttacgccga
Bhs001F	Forward EcoRI for a~eaeA_Display>	cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F	Removing the EcoRI site from eaeA_Display	GTTAATCAGAACTCATTTGCAAATGG
Bhs002R	Removing the EcoRI site from eaeA_Display	CCATTTGCAAATGAGTTCTGATTAAC
Bhs003R	Reverse BamHI for a~eaeA_Display>	GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
Osn0001-F	Forward Bglbricking of espP of Escherichia coli O157:H7 str. Sakai	ccagtGAATTCatgAGATCTgccccgtcagcatctgccac
Osn0002-R	Reverse Bglbricking of espP of Escherichia coli O157:H7 str. Sakai	gcagtGGATCCtcagaacgagtaacggaaattag
Odd001F	Forward EcoRI oligo for Tsh Autotransporter	ccataGAATTCatgAGATCTacacttttacctgtatacg
Odd002R	Reverse BamHI oligo for Tsh Autotransporter	ctgatGGATCCtcagaatgaataacgaatattagcg
Odd003F	Forward oligo for Ice Nucleation Protein	ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg
Odmd001F	Forward Oligo for Invasin (refactored, long)	ccataGAATTCatgAGATCTGCTGGGGCTTCAGAAAAATATGATGC
Odmd002R	Reverse Oligo for Invasin (refactored, long)	ccaaaGGATCCactggataccagcgatctgccg 
Ocr0001-F	forward oligo for biobricking of {a~Inv-short>}	ccaaaGAATTCatgAGATCTAATTATGATGGTTTTCCAGC
Ocr0001-R	reverse oligo for biobricking of  {a~Inv-short>}	ccaaaGGATCCactggataccagcgatctgccgc
Odmd003R	Reverse Oligo for Chal Lectin w/o Stop Codon 	ccaaaGGATCCctcgctgtcgtcctctcgta
Ons003F	Forward construction of Poly_bind basic part	ccataGAATTCatgAGATCTttcaaattctggctatacgaacatg
Ons004R	Reverse construction of Poly_bind basic part	ctgatGGATCCcccccgtattacatgttcgtatagccagaat
Ons001F	Forward oligo for TraT	ccataGAATTCatgAGATCTtgtggtgcgatgagcacagc
Ons002R	Reverse oligo for TraT	ctgatGGATCCgagaatatttgcgattgatttgg
Odvs003	Gene Synthesis of CBK basic part	CCATAGAATTCATGAGATCTGGTTCTGGTCCGACCCAGTCTCACTACGGTCAGTGCG
Odvs004	Gene Synthesis of CBK basic part	CGCAAACGGTCGGACCAGAGTAACCGATACCACCGCACTGACCGTAGTGAGACTG
Odvs005	Gene Synthesis of CBK basic part	CTCTGGTCCGACCGTTTGCGCTTCTGGTACCACCTGCCAGGTTCTGAACCCGTACTAC
Odvs006	Gene Synthesis of CBK basic part	GCTTAGGATCCACCAGAACCCAGGCACTGAGAGTAGTACGGGTTCAGAACCTGGC
OWRL-025-F	Forward construction of Aluminum Binding Peptide basic part	GCGTAgaattcATGagatctGTGCCGAGCAGCGGCCCGCAGGATACC
OWRL-026-R	Reverse construction of Aluminum Binding Peptide	TCATCggatccGGTGGTGCGGGTATCCTGCGGGCCGCTGC
Oph022F 	Foward oligo for cloning of {a~TraA>}	ccaaaGAATTCatgAGATCTacttatgaatgctgttttaagtgttcaggg
Oph023R	Reverse oligo for removal of stop codon {a~TraA>}	gcaaaGGATCCgaggccaacgacggccatac
js001F 	Forward biobricking of upaG (long) 	CCATAgaattcATGagatctcgcaaaattgttaatatggctgctg
js002R 	Reverse biobricking of upaG (long) 	CTGATggatccTTACCACtgaataccggcac
Oeh001F	Forward EcoRI/BglII oligo for <INP repeats>	gtcagGAATTCatgAGATCTaaccacagtgatctaattgc
Oeh001R 	Reverse BamHI oligo for <INP repeats>	gtcagGGATCCactgtcctgcccggccgttg
Odvs002F	Forward construction of AG4 basic part	ccataGAATTCATGAGATCTAACCCGTCTTCTCTGTTCCGTTACCTGCC
Odvs002R	Reverse construction of AG4 basic part	ctgatGGATCCGTCAGACGGCAGGTAACGGAACAGAGAAGACGG
OWRL-023-F	Forward biobricking of Intimin EaeA	GCGTAgaattcATGagatctAATGGTGAAAATTATTTTAAATTGGGTTCGG
Odvs0007F	Forward EcoRI/BglII for Bglbrick of ECOHLY	ccataGAATTCATGAGATCTtattccgtggaagaacttattgggacc
Odvs0007R	Reverse BamHI for Bglbrick of ECOHLY	ctgatGGATCCataaatatcattaccatatccacc
Odvs0008rF	Removing the BglII site in ECOHLY (Forward)	ggcagtgagggagcagaCctgcttgatggcgg
Odvs0008rR	Removing the BglII site in ECOHLY (Reverse)	ccgccatcaagcagGtctgctccctcactgcc
Omv044F	Forward Bglbricking of {<N.fliD>}	ccagtGAATTCatgAGATCTgcaagtatttcatcgctggg
Omv044R	Reverse Bglbricking of {<N.fliD>}	gcagtGGATCCttaaaaactttgtagcgcatcatcaccgc
Omv045F	Forward Removing BamHI site in {<N.fliD>}	cgttaagcggCatccgtgatgcc
Omv045R	Reverse Removing BamHI site in {<N.fliD>}	ggcatcacggatGccgcttaacg
Omv046F	Forward Bglbricking of {<C.fliD>}	ccagtGAATTCatgAGATCTgttgccgcccagaatgcg
Omv046R	Reverse Bglbricking of {<C.fliD>}	gcagtGGATCCcttggaattactgttgttttcg
Ovu015	Construction of cpx N term part	ctagaGAATTCatgAGATCTGGTCAGTCTggtgactacaacaaaaaccag
Ovu016	Construction of cpx N term part	gacaaGGATCCgaagcggtaaccaacagaggcaatccaggtgcctac
Ovu017	Construction of cpx C term part	ctagaGAATTCatgAGATCTgcgacttctactgtaactgg
Ovu018	Construction of cpx C term part	gacaaGGATCCttaagagcttgcagtacggcttttctcgg
Ovu019	SOEing of eCPX	gtcgcTTTAGACTGTTTAGATCCgaagcggtaaccaacag
Ovu020	SOEing of eCPX	GGATCTAAACAGTCTAAAgcgacttctactgtaactgg
Osc0030F	Forward Biobricking of ehaB	ggcctGAATTCattAGATCTggcttaatcgcaatgaactct
Osc0031R	Reverse Biobricking of ehaB	gtaccGGATCCttaccaggtatatttaacac
Omv047F	Forward construction of {<linker1>} basic part	ccataGAATTCatgAGATCTtacttcgatgtctggggcgcagggaccacggtcaccgtctcctcaggcggag
Omv047R	Reverse construction of {<linker1>} basic part	ctgatGGATCCtcctcctccagaaccacctccacctgaaccgcctccgcctgaggagacggtgac
Omv048F	Forward construction of {<linker2>} basic part	ccataGAATTCatgAGATCTtggacgttcggtggaggcaccaagctggaaatcaaacgtgcggccgctc
Omv048R	Reverse construction of {<linker2>} basic part	ctgatGGATCCacggccttcaatgccgtgatggtgatggtggtgagcggccgcacgtttgatttc
Ojw001	Forward construction of Z34C basic part	CCATAgaattcATGagatctTTCAACATGCAGTGCCAGCGTCGTTTCTACGAAGCTCTGCACGACCCGAACCTGAACGAAG
Ojw002	Reverse construction of Z34C basic part	CTGATggatccGCAGTCGTCACGGATAGATTTGATTTTAGCGTTACGCTGTTCTTCGTTCAGGTTCGGGTCG
Oph024F 	Foward oligo for cloning of {<KILR>}	ccataGAATTCatgAGATCTgttaaagaactggaagacaaaaacgaagaactgctgtctaaaatctaccacctgcg
Oph025R	Reverse oligo for cloning of {<KILR>}	ctgatGGATCCgcaaccaccacgttcaccaaccagttttttcagacgagcaacttcgttacgcaggtggtagattttagacagc
Osc0028F	Forward construction of Leucine zipper EILD	TCCGGgaattcATGagatctGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGTCTGAAATCTACCACCTGGACAACGAAG
Osc0029R	Reverse construction of Leucine zipper EILD	CTGGTggatccGCAACCACCACGTTCACCAACCAGTTTTTTCAGACGAGCAACTTCGTTGTCCAGGTGGTAG
Personal tools