SBB09 Construct5

From OpenWetWare

Jump to: navigation, search
Construction of {a~Int-native>} basic part
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7     (145 bp, gp = A)
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7     (1888 bp, gp = B)
----------------------------
PCR Bhs001F/Bhs003R on A+B                       (2008 bp, EcoRI/BamHI)
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
Product is pBca9495CA-M10024                     {a~Int-native>}
----------------------------
Bhs001F  Forward EcoRI for {a~Int-native>}           cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F  Removing the EcoRI site from {a~Int-native>}   GTTAATCAGAAcTCATTTGCAAATG
Bhs002R  Removing the EcoRI site from {a~Int-native>}   CATTTGCAAATGAgTTCTGATTAAC
Bhs003R  Reverse BamHI for {a~Int-native>}           GCAAAggatccGCCTTGGTTTGATCAAAAAATATAACCGCAC
 JCA:  There is a frame error on Bhs003R.  Revised:
Construction of {a~Int-native>} basic part
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7     (146 bp, gp = A)
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7     (1889 bp, gp = B)
----------------------------
PCR Bhs001F/Bhs003R on A+B                       (2009 bp, EcoRI/BamHI)
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
Product is pBca9495CA-M10024                     {a~Int-native>}
----------------------------
Bhs001F  Forward EcoRI for {a~Int-native>}          cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F  Removing the EcoRI site from {a~Int-native>}   GTTAATCAGAACTCATTTGCAAATGG
Bhs002R  Removing the EcoRI site from {a~Int-native>}  CCATTTGCAAATGAGTTCTGATTAAC
Bhs003R  Reverse BamHI for {a~Int-native>}          GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
Personal tools