SBB09 Construct2

From OpenWetWare

Jump to: navigation, search
PCR ca998/ca1363R on pBca9145-Bca9494       (1539 bp, EcoRI/BamHI)
Sub into pBca9495CA-Bca1144#5               (EcoRI/BamHI, 3039+910, L)
Product is pBca9495CA-Bca1363    {Pbad.rbs.pp.ST}
----
ca998	Forward Sequencing of pSB1A2/pSB1A3
gtatcacgaggcagaatttcag
ca1363R	Reverse StrepTag
ccataGGATCCctgcccagactgCCCTCCCTC
Personal tools